Quick Order

Rhesus EDAR/Ectodysplasin A Receptor Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus EDAR cDNA Clone Product Information
NCBI RefSeq:XM_001084259.2
RefSeq ORF Size:1347bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) ectodysplasin A receptor with N terminal His tag.
Gene Synonym:EDAR
Species:Rhesus
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Tumor necrosis factor receptor superfamily member EDAR is a Single-pass type I membrane protein. Edar was expressed reiteratively in signaling centers regulating key steps in morphogenesis. activin signaling from mesenchyme induces the expression of the TNF receptor edar in the epithelial signaling centers, thus making them responsive to Wnt-induced ectodysplasin from the nearby ectoderm. This is the first demonstration of integration of the Wnt, activin, and TNF signaling pathways. Defects in EDAR are a cause of ectodermal dysplasia anhidrotic (EDA), also known ectodermal dysplasia hypohidrotic autosomal recessive (HED). Ectodermal dysplasia defines a heterogeneous group of disorders due to abnormal development of two or more ectodermal structures. EDA is characterized by sparse hair (atrichosis or hypotrichosis), abnormal or missing teeth and the inability to sweat due to the absence of sweat glands.

References
  • Elomaa O, et al. (2001) Ectodysplasin is released by proteolytic shedding and binds to the EDAR protein. Hum Mol Genet. 10 (9): 953-62.
  • Koppinen P, et al. (2001) Signaling and subcellular localization of the TNF receptor Edar. Exp Cell Res. 269 (2): 180-92.
  • Chassaing N, et al. (2006) Mutations in EDAR account for one-quarter of non-ED1-related hypohidrotic ectodermal dysplasia. Hu. Mutat. 27 (3): 255-9.
  • Size / Price
    Catalog: CG90111-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"