Quick Order

Rhesus XEDAR/EDA2R Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus EDA2R cDNA Clone Product Information
NCBI RefSeq:NM_001193467.1
RefSeq ORF Size:894bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) ectodysplasin A2 receptor with C terminal Myc tag.
Gene Synonym:EDA2R
Species:Rhesus
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Tumor necrosis factor receptor superfamily member 27, also known as X-linked ectodysplasin-A2 receptor, EDA-A2 receptor, EDA2R, XEDAR and TNFRSF27, is a single-pass type I II membrane protein. TNFRSF27 / EDA2R contains three TNFR-Cys repeats. It is a new member of the tumor necrosis factor receptor family that has been shown to be highly expressed in ectodermal derivatives during embryonic development and binds to ectodysplasin-A2 (EDA-A2). TNFRSF27 / EDA2R is a receptor for EDA isoform A2, but not for EDA isoform A1. TNFRSF27 / EDA2R mediates the activation of the NF-kappa-B and JNK pathways. The activation seems to be mediated by binding to TRAF3 and TRAF6. Ectodysplasin, a member of the tumor necrosis factor family, is encoded by the anhidrotic ectodermal dysplasia EDA gene. Mutations in EDA give rise to a clinical syndrome characterized by loss of hair, sweat glands, and teeth. EDA-A1 and EDA-A2 are two isoforms of ectodysplasin that differ only by an insertion of two amino acids. This insertion functions to determine receptor binding specificity, such that EDA-A1 binds only the receptor EDAR, whereas EDA-A2 binds only the related, but distinct, X-linked ectodysplasin-A2 receptor (XEDAR).

References
  • Yan M., et al., 2000,Science. 290: 523-527.
  • Sinha S.K., et al., 2002, J. Biol. Chem. 277: 44953-44961.
  • Prodi, D.A. et al., 2008, J Invest Dermatol  128 (9):2268-70.
  • Size / Price
    Catalog: CG90110-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"