Quick Order

Cynomolgus ECH1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus ECH1 cDNA Clone Product Information
NCBI RefSeq:XM_005589131.1
RefSeq ORF Size:963bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) enoyl CoA hydratase 1, peroxisomal with C terminal His tag.
Gene Synonym:ECH1
Species:Cynomolgus
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

ECH1 is a member of the hydratase/isomerase superfamily. ECH1 shows high sequence similarity to enoyl-CoA hydratases of several species, particularly within a conserved domain characteristic of these proteins. ECH1 contains a C-terminal peroxisomal targeting sequence and localizes to peroxisomes. The rat ortholog, which localizes to the matrix of both the peroxisome and mitochondria, can isomerize 3-trans, 5-cis-dienoyl-CoA to 2-trans,4-trans-dienoyl-CoA, indicating that it is a delta3,5-delta2,4-dienoyl-CoA isomerase. ECH1 functions in the auxiliary step of the fatty acid beta-oxidation pathway. Expression of the rat gene is induced by peroxisome proliferators.

References
  • Kovalyov LI, et al. (2006) Polymorphism of delta3,5-delta2,4-dienoyl-coenzyme A isomerase (the ECH1 gene product protein) in human striated muscle tissue. Biochemistry Mosc. 71(4): 448-53.
  • Olsen JV, et al. (2006) Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell. 127(3):635-48.
  • FitzPatrick DR, et al. (1995) Isolation and characterization of rat and human cDNAs encoding a novel putative peroxisomal enoyl-CoA hydratase. Genomics. 27(3):457-66.
  • Size / Price
    Catalog: CG90439-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"