DYNLRB1 cDNA ORF Clone, Cynomolgus, C-HA tag

Cat: CG90452-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DYNLRB1 Reagents
CRO Services
Product recommended

All DYNLRB1 Reagents
DYNLRB1 cDNA ORF Clone, Cynomolgus, C-HA tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
291 bp
Description
Full length Clone DNA of Cynomolgus dynein, light chain, roadblock-type 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DYNLRB1 Background Information
Full Name
dynein, light chain, roadblock-type 1

DYNLRB1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
DYNLRB1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90452-G
DYNLRB1 cDNA ORF Clone, Cynomolgus, untagged CG90452-UT
DYNLRB1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90452-ACGLN
DYNLRB1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90452-ACG
DYNLRB1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90452-ANG
DYNLRB1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90452-ACR
DYNLRB1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90452-ANR
DYNLRB1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90452-CF
DYNLRB1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90452-NF
DYNLRB1 cDNA ORF Clone, Cynomolgus, C-His tag CG90452-CH
DYNLRB1 cDNA ORF Clone, Cynomolgus, N-His tag CG90452-NH
DYNLRB1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90452-NY
DYNLRB1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90452-CM
DYNLRB1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90452-NM

DYNLRB1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DYNLRB1 cDNA ORF Clone in Cloning Vector, Rat RG86141-U
DYNLRB1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86141-ACGLN

DYNLRB1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DYNLRB1 cDNA ORF Clone in Cloning Vector, Mouse MG52823-G
DYNLRB1 cDNA ORF Clone, Mouse, untagged MG52823-UT
DYNLRB1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52823-ACG
DYNLRB1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52823-ACGLN
DYNLRB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52823-ANG
DYNLRB1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52823-ACR
DYNLRB1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52823-ANR
DYNLRB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52823-CF
DYNLRB1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52823-NF
DYNLRB1 cDNA ORF Clone, Mouse, C-His tag MG52823-CH
DYNLRB1 cDNA ORF Clone, Mouse, N-His tag MG52823-NH
DYNLRB1 cDNA ORF Clone, Mouse, C-HA tag MG52823-CY
DYNLRB1 cDNA ORF Clone, Mouse, N-HA tag MG52823-NY
DYNLRB1 cDNA ORF Clone, Mouse, C-Myc tag MG52823-CM
DYNLRB1 cDNA ORF Clone, Mouse, N-Myc tag MG52823-NM

DYNLRB1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DYNLRB1 cDNA ORF Clone in Cloning Vector, Human HG19838-U
DYNLRB1 cDNA ORF Clone, Human, untagged HG19838-UT
DYNLRB1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19838-ACGLN
DYNLRB1 cDNA ORF Clone, Human, C-GFPSpark® tag HG19838-ACG
DYNLRB1 cDNA ORF Clone, Human, N-GFPSpark® tag HG19838-ANG
DYNLRB1 cDNA ORF Clone, Human, C-OFPSpark® tag HG19838-ACR
DYNLRB1 cDNA ORF Clone, Human, N-OFPSpark® tag HG19838-ANR
DYNLRB1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG19838-CF
DYNLRB1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG19838-NF
DYNLRB1 cDNA ORF Clone, Human, C-His tag HG19838-CH
DYNLRB1 cDNA ORF Clone, Human, N-His tag HG19838-NH
DYNLRB1 cDNA ORF Clone, Human, C-HA tag HG19838-CY
DYNLRB1 cDNA ORF Clone, Human, N-HA tag HG19838-NY
DYNLRB1 cDNA ORF Clone, Human, C-Myc tag HG19838-CM
DYNLRB1 cDNA ORF Clone, Human, N-Myc tag HG19838-NM
info info
添加购物车成功! 添加购物车失败!