DHX16 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag

Cat: CG90348-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DHX16 Reagents
CRO Services
Product recommended

All DHX16 Reagents
DHX16 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
3135 bp
Description
Full length Clone DNA of Cynomolgus DEAH (Asp-Glu-Ala-His) box polypeptide 16 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DHX16 Background Information
Full Name
DEAH (Asp-Glu-Ala-His) box polypeptide 16

DHX16 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
DHX16 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90348-G
DHX16 cDNA ORF Clone, Cynomolgus, untagged CG90348-UT
DHX16 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90348-ACG
DHX16 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90348-ACGLN
DHX16 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90348-ANG
DHX16 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90348-ACR
DHX16 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90348-ANR
DHX16 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90348-NF
DHX16 cDNA ORF Clone, Cynomolgus, C-His tag CG90348-CH
DHX16 cDNA ORF Clone, Cynomolgus, N-His tag CG90348-NH
DHX16 cDNA ORF Clone, Cynomolgus, C-HA tag CG90348-CY
DHX16 cDNA ORF Clone, Cynomolgus, N-HA tag CG90348-NY
DHX16 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90348-CM
DHX16 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90348-NM

DHX16 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DHX16 cDNA ORF Clone in Cloning Vector, Mouse MG5A5473-U
DHX16 cDNA ORF Clone, Mouse, untagged MG5A5473-UT
DHX16 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5473-ACG
DHX16 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5473-ACGLN
DHX16 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5473-ANG
DHX16 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5473-ACR
DHX16 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5473-ANR
DHX16 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5473-CF
DHX16 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5473-NF
DHX16 cDNA ORF Clone, Mouse, C-His tag MG5A5473-CH
DHX16 cDNA ORF Clone, Mouse, N-His tag MG5A5473-NH
DHX16 cDNA ORF Clone, Mouse, C-HA tag MG5A5473-CY
DHX16 cDNA ORF Clone, Mouse, N-HA tag MG5A5473-NY
DHX16 cDNA ORF Clone, Mouse, C-Myc tag MG5A5473-CM
DHX16 cDNA ORF Clone, Mouse, N-Myc tag MG5A5473-NM

DHX16 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DHX16 cDNA ORF Clone, Human, untagged HG21267-UT
info info
添加购物车成功! 添加购物车失败!