CXCR6 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag

Cat: CG90231-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CXCR6 Reagents
CRO Services
Product recommended

All CXCR6 Reagents
CXCR6 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1032 bp
Description
Full length Clone DNA of Rhesus chemokine (C-X-C motif) receptor 6 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCR6 Background Information
Full Name
chemokine (C-X-C motif) receptor 6

CXCR6 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CXCR6 cDNA ORF Clone in Cloning Vector, Rhesus CG90231-G
CXCR6 cDNA ORF Clone, Rhesus, untagged CG90231-UT
CXCR6 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90231-ACGLN
CXCR6 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90231-ACG
CXCR6 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90231-ACR
CXCR6 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90231-NF
CXCR6 cDNA ORF Clone, Rhesus, C-His tag CG90231-CH
CXCR6 cDNA ORF Clone, Rhesus, N-His tag CG90231-NH
CXCR6 cDNA ORF Clone, Rhesus, C-HA tag CG90231-CY
CXCR6 cDNA ORF Clone, Rhesus, N-HA tag CG90231-NY
CXCR6 cDNA ORF Clone, Rhesus, C-Myc tag CG90231-CM
CXCR6 cDNA ORF Clone, Rhesus, N-Myc tag CG90231-NM

CXCR6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CXCR6 cDNA ORF Clone in Cloning Vector, Rat RG80343-G
CXCR6 cDNA ORF Clone, Rat, untagged RG80343-UT
CXCR6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80343-ACG
CXCR6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80343-ACGLN
CXCR6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80343-ACR
CXCR6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80343-CF
CXCR6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80343-NF
CXCR6 cDNA ORF Clone, Rat, C-His tag RG80343-CH
CXCR6 cDNA ORF Clone, Rat, N-His tag RG80343-NH
CXCR6 cDNA ORF Clone, Rat, C-HA tag RG80343-CY
CXCR6 cDNA ORF Clone, Rat, N-HA tag RG80343-NY
CXCR6 cDNA ORF Clone, Rat, C-Myc tag RG80343-CM
CXCR6 cDNA ORF Clone, Rat, N-Myc tag RG80343-NM
CXCR6 qPCR Primer Pairs, Rat RP300313

CXCR6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CXCR6 cDNA ORF Clone in Cloning Vector, Mouse MG50844-G
CXCR6 cDNA ORF Clone, Mouse, untagged MG50844-UT
CXCR6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50844-ACGLN
CXCR6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50844-ACG
CXCR6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50844-ACR
CXCR6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50844-G-F
CXCR6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50844-CF
CXCR6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50844-NF
CXCR6 cDNA ORF Clone, Mouse, C-His tag MG50844-CH
CXCR6 cDNA ORF Clone, Mouse, N-His tag MG50844-NH
CXCR6 cDNA ORF Clone, Mouse, C-HA tag MG50844-CY
CXCR6 cDNA ORF Clone, Mouse, N-HA tag MG50844-NY
CXCR6 cDNA ORF Clone, Mouse, C-Myc tag MG50844-CM
CXCR6 cDNA ORF Clone, Mouse, N-Myc tag MG50844-NM
CXCR6 qPCR Primer Pairs, Mouse MP200815

CXCR6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CXCR6 cDNA ORF Clone, Human, untagged HG12504-UT
CXCR6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12504-ACGLN
CXCR6 qPCR Primer Pairs, Human HP104824
info info
添加购物车成功! 添加购物车失败!