CXCR3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag

Cat: CG90238-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CXCR3 Reagents
CRO Services
Product recommended

All CXCR3 Reagents
CXCR3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1107 bp
Description
Full length Clone DNA of Rhesus chemokine (C-X-C motif) receptor 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CXCR3 Background Information
Full Name
chemokine (C-X-C motif) receptor 3

CXCR3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CXCR3 cDNA ORF Clone in Cloning Vector, Rhesus CG90238-G
CXCR3 cDNA ORF Clone, Rhesus, untagged CG90238-UT
CXCR3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90238-ACG
CXCR3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90238-ACGLN
CXCR3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90238-ACR
CXCR3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90238-NF
CXCR3 cDNA ORF Clone, Rhesus, C-His tag CG90238-CH
CXCR3 cDNA ORF Clone, Rhesus, N-His tag CG90238-NH
CXCR3 cDNA ORF Clone, Rhesus, C-HA tag CG90238-CY
CXCR3 cDNA ORF Clone, Rhesus, N-HA tag CG90238-NY
CXCR3 cDNA ORF Clone, Rhesus, C-Myc tag CG90238-CM
CXCR3 cDNA ORF Clone, Rhesus, N-Myc tag CG90238-NM

CXCR3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CXCR3 cDNA ORF Clone in Cloning Vector, Mouse MG50842-G
CXCR3 cDNA ORF Clone, Mouse, untagged MG50842-UT
CXCR3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50842-ACGLN
CXCR3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50842-ACG
CXCR3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50842-ACR
CXCR3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50842-CF
CXCR3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50842-NF
CXCR3 cDNA ORF Clone, Mouse, C-His tag MG50842-CH
CXCR3 cDNA ORF Clone, Mouse, N-His tag MG50842-NH
CXCR3 cDNA ORF Clone, Mouse, C-HA tag MG50842-CY
CXCR3 cDNA ORF Clone, Mouse, N-HA tag MG50842-NY
CXCR3 cDNA ORF Clone, Mouse, C-Myc tag MG50842-CM
CXCR3 cDNA ORF Clone, Mouse, N-Myc tag MG50842-NM
CXCR3 qPCR Primer Pairs, Mouse MP200813
info info
添加购物车成功! 添加购物车失败!