Chymotrypsin-like protease cDNA ORF Clone, Cynomolgus, N-HA tag

Cat: CG90549-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Chymotrypsin-like protease Reagents
CRO Services
Product recommended

All Chymotrypsin-like protease Reagents
Chymotrypsin-like protease cDNA ORF Clone, Cynomolgus, N-HA tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
795 bp
Description
Full length Clone DNA of Cynomolgus chymotrypsin-like with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Chymotrypsin-like protease Background Information

CTRL-1, also known as chymotrypsin-like protease, belongs to the peptidase S1 family. CTRL-1 contains 1 peptidase S1 domain. Its expression is increased in preeclampsia (PE). Placental-derived chymotrypsin-like protease is responsible for inducing endothelial inflammatory phenotypic changes possibly by upregulation of cell adhesion molecule expressions, activation of cellular protease, and induction of extracellular regulated kinase phosphorylation. Activated microglia have been observed in various neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis, and multiple sclerosis. Five structurally distinct inhibitors that are known to inhibit chymotrypsin-like proteases were partially protective. They might represent a novel class of drugs with benefit in diseases where overactivity of microglia contributes to the pathogenesis.

Full Name
chymotrypsin-like
References
  • Yang Gu. et al., 2009, Reprod Sci. 16 (9): 905-13.
  • Klegeris A. et al., 2005, Glia. 51 (1):56-64.
  • Caroline V. Bamford. et al., 2007, nfect Immun. 75 (9): 4364-72.
  • Chymotrypsin-like protease cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    Chymotrypsin-like protease cDNA ORF Clone in Cloning Vector, Cynomolgus CG90549-U
    Chymotrypsin-like protease cDNA ORF Clone, Cynomolgus, untagged CG90549-UT
    Chymotrypsin-like protease cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90549-ACG
    Chymotrypsin-like protease Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90549-ACGLN
    Chymotrypsin-like protease cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90549-ACR
    Chymotrypsin-like protease cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90549-CF
    Chymotrypsin-like protease cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90549-NF
    Chymotrypsin-like protease cDNA ORF Clone, Cynomolgus, C-His tag CG90549-CH
    Chymotrypsin-like protease cDNA ORF Clone, Cynomolgus, N-His tag CG90549-NH
    Chymotrypsin-like protease cDNA ORF Clone, Cynomolgus, C-HA tag CG90549-CY
    Chymotrypsin-like protease cDNA ORF Clone, Cynomolgus, C-Myc tag CG90549-CM
    Chymotrypsin-like protease cDNA ORF Clone, Cynomolgus, N-Myc tag CG90549-NM

    Chymotrypsin-like protease cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Chymotrypsin-like protease cDNA ORF Clone in Cloning Vector, Mouse MG53788-U
    Chymotrypsin-like protease cDNA ORF Clone, Mouse, untagged MG53788-UT
    Chymotrypsin-like protease cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53788-ACG
    Chymotrypsin-like protease Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53788-ACGLN
    Chymotrypsin-like protease cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53788-ACR
    Chymotrypsin-like protease cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53788-CF
    Chymotrypsin-like protease cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53788-NF
    Chymotrypsin-like protease cDNA ORF Clone, Mouse, C-His tag MG53788-CH
    Chymotrypsin-like protease cDNA ORF Clone, Mouse, N-His tag MG53788-NH
    Chymotrypsin-like protease cDNA ORF Clone, Mouse, C-HA tag MG53788-CY
    Chymotrypsin-like protease cDNA ORF Clone, Mouse, N-HA tag MG53788-NY
    Chymotrypsin-like protease cDNA ORF Clone, Mouse, C-Myc tag MG53788-CM
    Chymotrypsin-like protease cDNA ORF Clone, Mouse, N-Myc tag MG53788-NM

    Chymotrypsin-like protease cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Chymotrypsin-like protease cDNA ORF Clone in Cloning Vector, Human HG13748-G
    Chymotrypsin-like protease cDNA ORF Clone, Human, untagged HG13748-UT
    Chymotrypsin-like protease Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13748-ACGLN
    Chymotrypsin-like protease cDNA ORF Clone, Human, C-GFPSpark® tag HG13748-ACG
    Chymotrypsin-like protease cDNA ORF Clone, Human, C-OFPSpark® tag HG13748-ACR
    Chymotrypsin-like protease cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13748-CF
    Chymotrypsin-like protease cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13748-NF
    Chymotrypsin-like protease cDNA ORF Clone, Human, C-His tag HG13748-CH
    Chymotrypsin-like protease cDNA ORF Clone, Human, N-His tag HG13748-NH
    Chymotrypsin-like protease cDNA ORF Clone, Human, C-HA tag HG13748-CY
    Chymotrypsin-like protease cDNA ORF Clone, Human, N-HA tag HG13748-NY
    Chymotrypsin-like protease cDNA ORF Clone, Human, C-Myc tag HG13748-CM
    Chymotrypsin-like protease cDNA ORF Clone, Human, N-Myc tag HG13748-NM
    Chymotrypsin-like protease qPCR Primer Pairs, Human HP102425
    info info
    添加购物车成功! 添加购物车失败!