M-CSF cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90029-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All M-CSF Reagents
CRO Services
Product recommended

All M-CSF Reagents
M-CSF cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1668 bp
Description
Full length Clone DNA of Rhesus colony stimulating factor 1 (macrophage) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

M-CSF Background Information

Macrophage colony-stimulating factor 1, also known as CSF-1, M-CSF, Lanimostim and CSF1, is a single-pass membrane protein which is disulfide-linked as a homodimer or heterodimer. Granulocyte / macrophage colony-stimulating factors are cytokines that act in hematopoiesis by controlling the production, differentiation, and function of 2 related white cell populations of the blood, the granulocytes and the monocytes-macrophages. M-CSF/CSF-1 is known to facilitate monocyte survival, monocyte-to-macrophage conversion, and macrophage proliferation. M-CSF/CSF-1 is a secreted cytokine which influences hemopoietic stem cells to differentiate into macrophages or other related cell types. It binds to the Colony stimulating factor 1 receptor. M-CSF/CSF-1 may also be involved in development of the placenta. The active form of M-CSF/CSF-1 is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. M-CSF/CSF-1 induces cells of the monocyte/macrophage lineage. It also plays a role in immunological defenses, bone metabolism, lipoproteins clearance, fertility and pregnancy. Upregulation of M-CSF/CSF-1 in the infarcted myocardium may have an active role in healing not only through its effects on cells of monocyte/macrophage lineage, but also by regulating endothelial cell chemokine expression.

Full Name
colony stimulating factor 1 (macrophage)
References
  1. Pandit J. et al., 1992, Science. 258: 1358-62.
  2. Tokai M. et al., 2000, J Bacteriol. 182 (10): 2865-8.
  3. Fan X. et al., 2001, Am J Physiol Endocrinol Metab. 280 (1): E103-11.
  4. Frangogiannis NG. et al., 2003, Am J Physiol Heart Circ Physiol. 285 (2): H483-92.
  5. Cupp JS. et al., 2007, Am J Surg Pathol. 31 (6): 970-6.

M-CSF cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
M-CSF cDNA ORF Clone in Cloning Vector, Rhesus CG90029-G
M-CSF cDNA ORF Clone, Rhesus, untagged CG90029-UT
M-CSF cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90029-ACG
M-CSF Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90029-ACGLN
M-CSF cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90029-ACR
M-CSF cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90029-CF
M-CSF cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90029-NF
M-CSF cDNA ORF Clone, Rhesus, C-His tag CG90029-CH
M-CSF cDNA ORF Clone, Rhesus, C-HA tag CG90029-CY
M-CSF cDNA ORF Clone, Rhesus, N-HA tag CG90029-NY
M-CSF cDNA ORF Clone, Rhesus, C-Myc tag CG90029-CM
M-CSF cDNA ORF Clone, Rhesus, N-Myc tag CG90029-NM

M-CSF cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
M-CSF cDNA ORF Clone in Cloning Vector, Human HG11792-G
M-CSF cDNA ORF Clone, Human, untagged HG11792-UT
M-CSF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11792-ACGLN
M-CSF cDNA ORF Clone, Human, C-GFPSpark® tag HG11792-ACG
M-CSF cDNA ORF Clone, Human, C-OFPSpark® tag HG11792-ACR
M-CSF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11792-CF
M-CSF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11792-NF
M-CSF cDNA ORF Clone, Human, C-His tag HG11792-CH
M-CSF cDNA ORF Clone, Human, N-His tag HG11792-NH
M-CSF cDNA ORF Clone, Human, C-HA tag HG11792-CY
M-CSF cDNA ORF Clone, Human, N-HA tag HG11792-NY
M-CSF cDNA ORF Clone, Human, C-Myc tag HG11792-CM
M-CSF cDNA ORF Clone, Human, N-Myc tag HG11792-NM
M-CSF qPCR Primer Pairs, Human HP102569
info info
添加购物车成功! 添加购物车失败!