mu Crystallin/CRYM cDNA ORF Clone, Rhesus, C-His tag

Cat: CG90460-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All mu Crystallin/CRYM Reagents
CRO Services
Product recommended

All mu Crystallin/CRYM Reagents
mu Crystallin/CRYM cDNA ORF Clone, Rhesus, C-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
945 bp
Description
Full length Clone DNA of Rhesus crystallin, mu with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

mu Crystallin/CRYM Background Information
Full Name
crystallin, mu

mu Crystallin/CRYM cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
mu Crystallin/CRYM cDNA ORF Clone in Cloning Vector, Rhesus CG90460-G
mu Crystallin/CRYM cDNA ORF Clone, Rhesus, untagged CG90460-UT
mu Crystallin/CRYM Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90460-ACGLN
mu Crystallin/CRYM cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90460-ACG
mu Crystallin/CRYM cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90460-ANG
mu Crystallin/CRYM cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90460-ACR
mu Crystallin/CRYM cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90460-ANR
mu Crystallin/CRYM cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90460-CF
mu Crystallin/CRYM cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90460-NF
mu Crystallin/CRYM cDNA ORF Clone, Rhesus, N-His tag CG90460-NH
mu Crystallin/CRYM cDNA ORF Clone, Rhesus, C-HA tag CG90460-CY
mu Crystallin/CRYM cDNA ORF Clone, Rhesus, N-HA tag CG90460-NY
mu Crystallin/CRYM cDNA ORF Clone, Rhesus, C-Myc tag CG90460-CM
mu Crystallin/CRYM cDNA ORF Clone, Rhesus, N-Myc tag CG90460-NM

mu Crystallin/CRYM cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
mu Crystallin/CRYM cDNA ORF Clone in Cloning Vector, Rat RG83933-U
mu Crystallin/CRYM Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83933-ACGLN

mu Crystallin/CRYM cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
mu Crystallin/CRYM cDNA ORF Clone in Cloning Vector, Mouse MG51760-U
mu Crystallin/CRYM cDNA ORF Clone, Mouse, untagged MG51760-UT
mu Crystallin/CRYM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51760-ACGLN
mu Crystallin/CRYM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51760-ACG
mu Crystallin/CRYM cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51760-ANG
mu Crystallin/CRYM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51760-ACR
mu Crystallin/CRYM cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51760-ANR
mu Crystallin/CRYM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51760-CF
mu Crystallin/CRYM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51760-NF
mu Crystallin/CRYM cDNA ORF Clone, Mouse, C-His tag MG51760-CH
mu Crystallin/CRYM cDNA ORF Clone, Mouse, N-His tag MG51760-NH
mu Crystallin/CRYM cDNA ORF Clone, Mouse, C-HA tag MG51760-CY
mu Crystallin/CRYM cDNA ORF Clone, Mouse, N-HA tag MG51760-NY
mu Crystallin/CRYM cDNA ORF Clone, Mouse, C-Myc tag MG51760-CM
mu Crystallin/CRYM cDNA ORF Clone, Mouse, N-Myc tag MG51760-NM
mu Crystallin/CRYM qPCR Primer Pairs, Mouse MP201633

mu Crystallin/CRYM cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
mu Crystallin/CRYM cDNA ORF Clone, Human, untagged HG19839-UT
info info
添加购物车成功! 添加购物车失败!