CPLX1 cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90677-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CPLX1 Reagents
CRO Services
Product recommended

All CPLX1 Reagents
CPLX1 cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
405 bp
Description
Full length Clone DNA of Rhesus complexin 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CPLX1 Background Information
Full Name
complexin 1

CPLX1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CPLX1 cDNA ORF Clone in Cloning Vector, Rhesus CG90677-G
CPLX1 cDNA ORF Clone, Rhesus, untagged CG90677-UT
CPLX1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90677-ACG
CPLX1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90677-ACGLN
CPLX1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90677-ANG
CPLX1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90677-ACR
CPLX1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90677-ANR
CPLX1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90677-CF
CPLX1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90677-NF
CPLX1 cDNA ORF Clone, Rhesus, C-His tag CG90677-CH
CPLX1 cDNA ORF Clone, Rhesus, C-HA tag CG90677-CY
CPLX1 cDNA ORF Clone, Rhesus, N-HA tag CG90677-NY
CPLX1 cDNA ORF Clone, Rhesus, C-Myc tag CG90677-CM
CPLX1 cDNA ORF Clone, Rhesus, N-Myc tag CG90677-NM

CPLX1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CPLX1 cDNA ORF Clone in Cloning Vector, Mouse MG52600-U
CPLX1 cDNA ORF Clone, Mouse, untagged MG52600-UT
CPLX1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52600-ACGLN
CPLX1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52600-ACG
CPLX1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52600-ANG
CPLX1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52600-ACR
CPLX1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52600-ANR
CPLX1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52600-CF
CPLX1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52600-NF
CPLX1 cDNA ORF Clone, Mouse, C-His tag MG52600-CH
CPLX1 cDNA ORF Clone, Mouse, N-His tag MG52600-NH
CPLX1 cDNA ORF Clone, Mouse, C-HA tag MG52600-CY
CPLX1 cDNA ORF Clone, Mouse, N-HA tag MG52600-NY
CPLX1 cDNA ORF Clone, Mouse, C-Myc tag MG52600-CM
CPLX1 cDNA ORF Clone, Mouse, N-Myc tag MG52600-NM
CPLX1 qPCR Primer Pairs, Mouse MP202471

CPLX1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CPLX1 cDNA ORF Clone in Cloning Vector, Human HG14348-G
CPLX1 cDNA ORF Clone, Human, untagged HG14348-UT
CPLX1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14348-ACGLN
CPLX1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14348-ACG
CPLX1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14348-ANG
CPLX1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14348-ACR
CPLX1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14348-ANR
CPLX1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14348-CF
CPLX1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14348-NF
CPLX1 cDNA ORF Clone, Human, C-His tag HG14348-CH
CPLX1 cDNA ORF Clone, Human, N-His tag HG14348-NH
CPLX1 cDNA ORF Clone, Human, C-HA tag HG14348-CY
CPLX1 cDNA ORF Clone, Human, N-HA tag HG14348-NY
CPLX1 cDNA ORF Clone, Human, C-Myc tag HG14348-CM
CPLX1 cDNA ORF Clone, Human, N-Myc tag HG14348-NM
CPLX1 qPCR Primer Pairs, Human HP102997
info info
添加购物车成功! 添加购物车失败!