Quick Order

Text Size:AAA

Cynomolgus Carboxypeptidase A1/CPA1 Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus CPA1 cDNA Clone Product Information
NCBI RefSeq:XM_005550773.1
RefSeq ORF Size:1260bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) carboxypeptidase A1 (pancreatic) with N terminal Flag tag.
Gene Synonym:CPA1
Species:Cynomolgus
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Human Carboxypeptidase A1 (CPA1)is secreted as a pancreatic procarboxypeptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group, with the preference of  residues with aromatic or branched aliphatic side chains. CPA1 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. In contrast to procarboxypeptidase B which was always secreted by the pancreas as a monomer, procarboxypeptidase A occurs as a monomer and/or associated to one or two functionally different proteins, such as zymogen E, and is involved in zymogen inhibition. Three different forms of human pancreatic procarboxypeptidase A have been isolated.

References
  • Catasus, L. et al., 1992, Biochem. J. 287: 299-303.
  • Moulard, M. et al., 1990, FEBS. Lett. 261: 179-183.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Size / Price
    Catalog: CG90550-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"