COPS7A cDNA ORF Clone, Rhesus, N-HA tag

Cat: CG90516-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All COPS7A Reagents
CRO Services
Product recommended

All COPS7A Reagents
COPS7A cDNA ORF Clone, Rhesus, N-HA tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
828 bp
Description
Full length Clone DNA of Rhesus COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COPS7A Background Information
Full Name
COP9 signalosome subunit 7A

COPS7A cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
COPS7A cDNA ORF Clone in Cloning Vector, Rhesus CG90516-G
COPS7A cDNA ORF Clone, Rhesus, untagged CG90516-UT
COPS7A Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90516-ACGLN
COPS7A cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90516-ACG
COPS7A cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90516-ANG
COPS7A cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90516-ACR
COPS7A cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90516-ANR
COPS7A cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90516-CF
COPS7A cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90516-NF
COPS7A cDNA ORF Clone, Rhesus, C-His tag CG90516-CH
COPS7A cDNA ORF Clone, Rhesus, N-His tag CG90516-NH
COPS7A cDNA ORF Clone, Rhesus, C-HA tag CG90516-CY
COPS7A cDNA ORF Clone, Rhesus, C-Myc tag CG90516-CM
COPS7A cDNA ORF Clone, Rhesus, N-Myc tag CG90516-NM

COPS7A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
COPS7A cDNA ORF Clone in Cloning Vector, Rat RG81268-U
COPS7A cDNA ORF Clone, Rat, untagged RG81268-UT
COPS7A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81268-ACGLN
COPS7A cDNA ORF Clone, Rat, C-GFPSpark® tag RG81268-ACG
COPS7A cDNA ORF Clone, Rat, N-GFPSpark® tag RG81268-ANG
COPS7A cDNA ORF Clone, Rat, C-OFPSpark® tag RG81268-ACR
COPS7A cDNA ORF Clone, Rat, N-OFPSpark® tag RG81268-ANR
COPS7A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81268-CF
COPS7A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81268-NF
COPS7A cDNA ORF Clone, Rat, C-His tag RG81268-CH
COPS7A cDNA ORF Clone, Rat, N-His tag RG81268-NH
COPS7A cDNA ORF Clone, Rat, C-HA tag RG81268-CY
COPS7A cDNA ORF Clone, Rat, N-HA tag RG81268-NY
COPS7A cDNA ORF Clone, Rat, C-Myc tag RG81268-CM
COPS7A cDNA ORF Clone, Rat, N-Myc tag RG81268-NM
COPS7A qPCR Primer Pairs, Rat RP301224

COPS7A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COPS7A cDNA ORF Clone in Cloning Vector, Mouse MG51433-G
COPS7A cDNA ORF Clone, Mouse, untagged MG51433-UT
COPS7A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51433-ACG
COPS7A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51433-ACGLN
COPS7A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51433-ANG
COPS7A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51433-ACR
COPS7A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51433-ANR
COPS7A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51433-CF
COPS7A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51433-NF
COPS7A cDNA ORF Clone, Mouse, C-His tag MG51433-CH
COPS7A cDNA ORF Clone, Mouse, N-His tag MG51433-NH
COPS7A cDNA ORF Clone, Mouse, C-HA tag MG51433-CY
COPS7A cDNA ORF Clone, Mouse, N-HA tag MG51433-NY
COPS7A cDNA ORF Clone, Mouse, C-Myc tag MG51433-CM
COPS7A cDNA ORF Clone, Mouse, N-Myc tag MG51433-NM
COPS7A qPCR Primer Pairs, Mouse MP201317
info info
添加购物车成功! 添加购物车失败!