CMSS1 cDNA ORF Clone, Rhesus, N-HA tag

Cat: CG90547-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CMSS1 Reagents
CRO Services
Product recommended

All CMSS1 Reagents
CMSS1 cDNA ORF Clone, Rhesus, N-HA tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
840 bp
Description
Full length Clone DNA of Rhesus cms1 ribosomal small subunit homolog (yeast) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CMSS1 Background Information
Full Name
cms1 ribosomal small subunit homolog (yeast)

CMSS1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CMSS1 cDNA ORF Clone in Cloning Vector, Rhesus CG90547-U
CMSS1 cDNA ORF Clone, Rhesus, untagged CG90547-UT
CMSS1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90547-ACGLN
CMSS1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90547-ACG
CMSS1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90547-ANG
CMSS1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90547-ACR
CMSS1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90547-ANR
CMSS1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90547-CF
CMSS1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90547-NF
CMSS1 cDNA ORF Clone, Rhesus, C-His tag CG90547-CH
CMSS1 cDNA ORF Clone, Rhesus, N-His tag CG90547-NH
CMSS1 cDNA ORF Clone, Rhesus, C-HA tag CG90547-CY
CMSS1 cDNA ORF Clone, Rhesus, C-Myc tag CG90547-CM
CMSS1 cDNA ORF Clone, Rhesus, N-Myc tag CG90547-NM

CMSS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CMSS1 cDNA ORF Clone in Cloning Vector, Human HG17105-U
CMSS1 cDNA ORF Clone, Human, untagged HG17105-UT
CMSS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17105-ACGLN
CMSS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17105-ACG
CMSS1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17105-ANG
CMSS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17105-ACR
CMSS1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17105-ANR
CMSS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17105-CF
CMSS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17105-NF
CMSS1 cDNA ORF Clone, Human, C-His tag HG17105-CH
CMSS1 cDNA ORF Clone, Human, N-His tag HG17105-NH
CMSS1 cDNA ORF Clone, Human, C-HA tag HG17105-CY
CMSS1 cDNA ORF Clone, Human, N-HA tag HG17105-NY
CMSS1 cDNA ORF Clone, Human, C-Myc tag HG17105-CM
CMSS1 cDNA ORF Clone, Human, N-Myc tag HG17105-NM
info info
添加购物车成功! 添加购物车失败!