CIRBP cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90629-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CIRBP Reagents
CRO Services
Product recommended

All CIRBP Reagents
CIRBP cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
519 bp
Description
Full length Clone DNA of Rhesus cold inducible RNA binding protein with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CIRBP Background Information

CIRBP, also known as cold-inducible RNA-binding protein, plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. CIRBP responds to a wide array of cellular stresses, including short wavelength ultraviolet light (UVC), at the transcriptional and post-translational level. It acts as a translational activator.CIRBP can bind the 3 translated region of specific transcripts to stabilize them and facilitate their transport to ribosomes for translation. CIRBP affects NF-κB signaling as opposed to IL1B mRNA stability directly.

Full Name
cold inducible RNA binding protein
References
  • Artero-Castro A. et al., 2009, Mol Cell Biol. 29 (7): 1855-68.
  • Zeng Y. et al., 2009, J Cell Biochem. 107 (1): 179-88.
  • Brochu C. et al., 2013, PLoS One. 8 (2): e57426.
  • CIRBP cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CIRBP cDNA ORF Clone in Cloning Vector, Rhesus CG90629-G
    CIRBP cDNA ORF Clone, Rhesus, untagged CG90629-UT
    CIRBP Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90629-ACGLN
    CIRBP cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90629-ACG
    CIRBP cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90629-ANG
    CIRBP cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90629-ACR
    CIRBP cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90629-ANR
    CIRBP cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90629-CF
    CIRBP cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90629-NF
    CIRBP cDNA ORF Clone, Rhesus, C-His tag CG90629-CH
    CIRBP cDNA ORF Clone, Rhesus, C-HA tag CG90629-CY
    CIRBP cDNA ORF Clone, Rhesus, N-HA tag CG90629-NY
    CIRBP cDNA ORF Clone, Rhesus, C-Myc tag CG90629-CM
    CIRBP cDNA ORF Clone, Rhesus, N-Myc tag CG90629-NM

    CIRBP cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CIRBP cDNA ORF Clone in Cloning Vector, Human HG14578-G
    CIRBP cDNA ORF Clone, Human, untagged HG14578-UT
    CIRBP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14578-ACGLN
    CIRBP cDNA ORF Clone, Human, C-GFPSpark® tag HG14578-ACG
    CIRBP cDNA ORF Clone, Human, N-GFPSpark® tag HG14578-ANG
    CIRBP cDNA ORF Clone, Human, C-OFPSpark® tag HG14578-ACR
    CIRBP cDNA ORF Clone, Human, N-OFPSpark® tag HG14578-ANR
    CIRBP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14578-CF
    CIRBP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14578-NF
    CIRBP cDNA ORF Clone, Human, C-His tag HG14578-CH
    CIRBP cDNA ORF Clone, Human, N-His tag HG14578-NH
    CIRBP cDNA ORF Clone, Human, C-HA tag HG14578-CY
    CIRBP cDNA ORF Clone, Human, N-HA tag HG14578-NY
    CIRBP cDNA ORF Clone, Human, C-Myc tag HG14578-CM
    CIRBP cDNA ORF Clone, Human, N-Myc tag HG14578-NM
    CIRBP qPCR Primer Pairs, Human HP103214
    info info
    添加购物车成功! 添加购物车失败!