Quick Order

Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus CIRBP cDNA Clone Product Information
NCBI RefSeq:NM_001261316.1
RefSeq ORF Size:519bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) cold inducible RNA binding protein with N terminal His tag.
Gene Synonym:CIRBP
Species:Rhesus
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-GFPSpark tagCG90629-ACG$225
Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-OFPSpark tagCG90629-ACR$225
Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-GFPSpark tagCG90629-ANG$225
Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-OFPSpark tagCG90629-ANR$225
Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-Flag tagCG90629-CF$195
Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-His tagCG90629-CH$195
Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-Myc tagCG90629-CM$195
Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-HA tagCG90629-CY$195
Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone in cloning vectorCG90629-G$75
Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-Flag tagCG90629-NF$195
Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-His tagCG90629-NH$195
Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-Myc tagCG90629-NM$195
Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-HA tagCG90629-NY$195
Rhesus CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmidCG90629-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

CIRBP, also known as cold-inducible RNA-binding protein, plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. CIRBP responds to a wide array of cellular stresses, including short wavelength ultraviolet light (UVC), at the transcriptional and post-translational level. It acts as a translational activator.CIRBP can bind the 3 translated region of specific transcripts to stabilize them and facilitate their transport to ribosomes for translation. CIRBP affects NF-κB signaling as opposed to IL1B mRNA stability directly.

References
  • Artero-Castro A. et al., 2009, Mol Cell Biol. 29 (7): 1855-68.
  • Zeng Y. et al., 2009, J Cell Biochem. 107 (1): 179-88.
  • Brochu C. et al., 2013, PLoS One. 8 (2): e57426.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"