Cofilin cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90578-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cofilin Reagents
CRO Services
Product recommended

All Cofilin Reagents
Cofilin cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
501 bp
Description
Full length Clone DNA of Rhesus cofilin 1 (non-muscle) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cofilin Background Information

CFL1, also known as n-cofilin, is a member of the ADF/Cofilin family. This family comprises three genes: CFL1, CFL2 and DSTN (destrin). ADF/Cofilin family members bind G-actin monomers and depolymerize actin filaments through two mechanisms: severing and increasing the off-rate for actin monomers from the pointed end. Cofilin also binds with other proteins such as myosin, tropomyosin, α-actinin, gelsolin and scruin. These proteins compete with cofilin for actin binding. Сofilin also plays a role in innate immune response. CFL1 contains 1 ADF-H domain and is widely distributed in various tissues. It is important for normal progress through mitosis and normal cytokinesis.

Full Name
cofilin 1 (non-muscle)
References
  • Lappalainen P. et al., 1997, Nature. 388 (6637): 78-82.
  • Ichetovkin I. et al., 2000, Cell Motil. 45 (4): 293-306.
  • Carlier MF. et al., 1997, J Cell Biol. 136 (6): 1307-22.
  • Cofilin cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    Cofilin cDNA ORF Clone in Cloning Vector, Canine DG70184-U
    Cofilin cDNA ORF Clone, Canine, untagged DG70184-UT
    Cofilin Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70184-ACGLN
    Cofilin cDNA ORF Clone, Canine, C-GFPSpark® tag DG70184-ACG
    Cofilin cDNA ORF Clone, Canine, N-GFPSpark® tag DG70184-ANG
    Cofilin cDNA ORF Clone, Canine, C-OFPSpark® tag DG70184-ACR
    Cofilin cDNA ORF Clone, Canine, N-OFPSpark® tag DG70184-ANR
    Cofilin cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70184-CF
    Cofilin cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70184-NF
    Cofilin cDNA ORF Clone, Canine, C-His tag DG70184-CH
    Cofilin cDNA ORF Clone, Canine, N-His tag DG70184-NH
    Cofilin cDNA ORF Clone, Canine, C-HA tag DG70184-CY
    Cofilin cDNA ORF Clone, Canine, N-HA tag DG70184-NY
    Cofilin cDNA ORF Clone, Canine, C-Myc tag DG70184-CM
    Cofilin cDNA ORF Clone, Canine, N-Myc tag DG70184-NM

    Cofilin cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Cofilin cDNA ORF Clone in Cloning Vector, Rhesus CG90578-G
    Cofilin cDNA ORF Clone, Rhesus, untagged CG90578-UT
    Cofilin cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90578-ACG
    Cofilin Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90578-ACGLN
    Cofilin cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90578-ANG
    Cofilin cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90578-ACR
    Cofilin cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90578-ANR
    Cofilin cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90578-CF
    Cofilin cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90578-NF
    Cofilin cDNA ORF Clone, Rhesus, C-His tag CG90578-CH
    Cofilin cDNA ORF Clone, Rhesus, N-His tag CG90578-NH
    Cofilin cDNA ORF Clone, Rhesus, C-HA tag CG90578-CY
    Cofilin cDNA ORF Clone, Rhesus, N-HA tag CG90578-NY
    Cofilin cDNA ORF Clone, Rhesus, N-Myc tag CG90578-NM

    Cofilin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Cofilin cDNA ORF Clone in Cloning Vector, Rat RG82408-U
    Cofilin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82408-ACGLN

    Cofilin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cofilin cDNA ORF Clone in Cloning Vector, Mouse MG51445-G
    Cofilin cDNA ORF Clone, Mouse, untagged MG51445-UT
    Cofilin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51445-ACG
    Cofilin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51445-ACGLN
    Cofilin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51445-ANG
    Cofilin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51445-ACR
    Cofilin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51445-ANR
    Cofilin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51445-CF
    Cofilin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51445-NF
    Cofilin cDNA ORF Clone, Mouse, C-His tag MG51445-CH
    Cofilin cDNA ORF Clone, Mouse, N-His tag MG51445-NH
    Cofilin cDNA ORF Clone, Mouse, C-HA tag MG51445-CY
    Cofilin cDNA ORF Clone, Mouse, N-HA tag MG51445-NY
    Cofilin cDNA ORF Clone, Mouse, C-Myc tag MG51445-CM
    Cofilin cDNA ORF Clone, Mouse, N-Myc tag MG51445-NM
    Cofilin qPCR Primer Pairs, Mouse MP201329

    Cofilin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cofilin cDNA ORF Clone in Cloning Vector, Human HG14544-G
    Cofilin cDNA ORF Clone, Human, untagged HG14544-UT
    Cofilin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14544-ACGLN
    Cofilin cDNA ORF Clone, Human, C-GFPSpark® tag HG14544-ACG
    Cofilin cDNA ORF Clone, Human, N-GFPSpark® tag HG14544-ANG
    Cofilin cDNA ORF Clone, Human, C-OFPSpark® tag HG14544-ACR
    Cofilin cDNA ORF Clone, Human, N-OFPSpark® tag HG14544-ANR
    Cofilin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14544-CF
    Cofilin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14544-NF
    Cofilin cDNA ORF Clone, Human, C-His tag HG14544-CH
    Cofilin cDNA ORF Clone, Human, N-His tag HG14544-NH
    Cofilin cDNA ORF Clone, Human, C-HA tag HG14544-CY
    Cofilin cDNA ORF Clone, Human, N-HA tag HG14544-NY
    Cofilin cDNA ORF Clone, Human, C-Myc tag HG14544-CM
    Cofilin cDNA ORF Clone, Human, N-Myc tag HG14544-NM
    Cofilin qPCR Primer Pairs, Human HP103191
    info info
    添加购物车成功! 添加购物车失败!