BM88/CEND1 cDNA ORF Clone, Rhesus, C-His tag

Cat: CG90420-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BM88/CEND1 Reagents
CRO Services
Product recommended

All BM88/CEND1 Reagents
BM88/CEND1 cDNA ORF Clone, Rhesus, C-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
459 bp
Description
Full length Clone DNA of Rhesus cell cycle exit and neuronal differentiation 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BM88/CEND1 Background Information
Full Name
cell cycle exit and neuronal differentiation 1

BM88/CEND1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
BM88/CEND1 cDNA ORF Clone in Cloning Vector, Rhesus CG90420-G
BM88/CEND1 cDNA ORF Clone, Rhesus, untagged CG90420-UT
BM88/CEND1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90420-ACGLN
BM88/CEND1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90420-ACG
BM88/CEND1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90420-ACR
BM88/CEND1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90420-CF
BM88/CEND1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90420-NF
BM88/CEND1 cDNA ORF Clone, Rhesus, N-His tag CG90420-NH
BM88/CEND1 cDNA ORF Clone, Rhesus, C-HA tag CG90420-CY
BM88/CEND1 cDNA ORF Clone, Rhesus, N-HA tag CG90420-NY
BM88/CEND1 cDNA ORF Clone, Rhesus, C-Myc tag CG90420-CM
BM88/CEND1 cDNA ORF Clone, Rhesus, N-Myc tag CG90420-NM

BM88/CEND1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BM88/CEND1 cDNA ORF Clone in Cloning Vector, Mouse MG51564-G
BM88/CEND1 cDNA ORF Clone, Mouse, untagged MG51564-UT
BM88/CEND1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51564-ACG
BM88/CEND1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51564-ACGLN
BM88/CEND1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51564-ANG
BM88/CEND1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51564-ACR
BM88/CEND1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51564-ANR
BM88/CEND1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51564-CF
BM88/CEND1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51564-NF
BM88/CEND1 cDNA ORF Clone, Mouse, C-His tag MG51564-CH
BM88/CEND1 cDNA ORF Clone, Mouse, N-His tag MG51564-NH
BM88/CEND1 cDNA ORF Clone, Mouse, C-HA tag MG51564-CY
BM88/CEND1 cDNA ORF Clone, Mouse, N-HA tag MG51564-NY
BM88/CEND1 cDNA ORF Clone, Mouse, C-Myc tag MG51564-CM
BM88/CEND1 cDNA ORF Clone, Mouse, N-Myc tag MG51564-NM
BM88/CEND1 qPCR Primer Pairs, Mouse MP201447
info info
添加购物车成功! 添加购物车失败!