CDC40 cDNA ORF Clone, Cynomolgus, N-His tag

Cat: CG90673-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CDC40 Reagents
CRO Services
Product recommended

All CDC40 Reagents
CDC40 cDNA ORF Clone, Cynomolgus, N-His tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1740 bp
Description
Full length Clone DNA of Cynomolgus cell division cycle 40 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDC40 Background Information
Full Name
cell division cycle 40

CDC40 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
CDC40 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90673-G
CDC40 cDNA ORF Clone, Cynomolgus, untagged CG90673-UT
CDC40 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90673-ACGLN
CDC40 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90673-ACG
CDC40 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90673-ANG
CDC40 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90673-ACR
CDC40 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90673-ANR
CDC40 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90673-CF
CDC40 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90673-NF
CDC40 cDNA ORF Clone, Cynomolgus, C-His tag CG90673-CH
CDC40 cDNA ORF Clone, Cynomolgus, C-HA tag CG90673-CY
CDC40 cDNA ORF Clone, Cynomolgus, N-HA tag CG90673-NY
CDC40 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90673-CM
CDC40 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90673-NM

CDC40 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CDC40 cDNA ORF Clone in Cloning Vector, Human HG13691-G
CDC40 cDNA ORF Clone, Human, untagged HG13691-UT
CDC40 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13691-ACGLN
CDC40 cDNA ORF Clone, Human, C-GFPSpark® tag HG13691-ACG
CDC40 cDNA ORF Clone, Human, N-GFPSpark® tag HG13691-ANG
CDC40 cDNA ORF Clone, Human, C-OFPSpark® tag HG13691-ACR
CDC40 cDNA ORF Clone, Human, N-OFPSpark® tag HG13691-ANR
CDC40 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13691-CF
CDC40 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13691-NF
CDC40 cDNA ORF Clone, Human, C-His tag HG13691-CH
CDC40 cDNA ORF Clone, Human, N-His tag HG13691-NH
CDC40 cDNA ORF Clone, Human, C-HA tag HG13691-CY
CDC40 cDNA ORF Clone, Human, N-HA tag HG13691-NY
CDC40 cDNA ORF Clone, Human, C-Myc tag HG13691-CM
CDC40 cDNA ORF Clone, Human, N-Myc tag HG13691-NM
CDC40 qPCR Primer Pairs, Human HP102370
info info
添加购物车成功! 添加购物车失败!