CD81 cDNA ORF Clone, Rhesus, C-Myc tag

Cat: CG90201-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD81 Reagents
CRO Services
Product recommended

All CD81 Reagents
CD81 cDNA ORF Clone, Rhesus, C-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
711 bp
Description
Full length Clone DNA of Rhesus CD81 molecule with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD81 Background Information

CD81, also known as TAPA-1, belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Members of this family mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility.CD81 is a widely expressed cell-surface protein involved in an astonishing variety of biologic responses. It is related to adhesion, morphology, activation, proliferation, and differentiation of B, T, and other cells. On B cells CD81 is part of a complex with CD21, CD19, and Leu13. This complex reduces the threshold for B cell activation via the B cell receptor by bridging Ag specific recognition and CD21-mediated complement recognition.

Full Name
CD81 molecule
References
  • Petracca R. et al., 2000, J Virol. 74 (10): 4824-30.
  • Bartosch B. et al., 2003, The Journal of Biological Chemistry. 278 (43): 41624-30.
  • Clark KL. et al., 2001, Journal of Immunology. 167 (9): 5115-21.
  • CD81 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD81 cDNA ORF Clone in Cloning Vector, Rhesus CG90201-G
    CD81 cDNA ORF Clone, Rhesus, untagged CG90201-UT
    CD81 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90201-ACG
    CD81 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90201-ACGLN
    CD81 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90201-ACR
    CD81 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90201-CF
    CD81 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90201-NF
    CD81 cDNA ORF Clone, Rhesus, C-His tag CG90201-CH
    CD81 cDNA ORF Clone, Rhesus, N-His tag CG90201-NH
    CD81 cDNA ORF Clone, Rhesus, C-HA tag CG90201-CY
    CD81 cDNA ORF Clone, Rhesus, N-HA tag CG90201-NY
    CD81 cDNA ORF Clone, Rhesus, N-Myc tag CG90201-NM

    CD81 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD81 cDNA ORF Clone in Cloning Vector, Rat RG80331-G
    CD81 cDNA ORF Clone, Rat, untagged RG80331-UT
    CD81 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80331-ACGLN
    CD81 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80331-ACG
    CD81 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80331-ACR
    CD81 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80331-CF
    CD81 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80331-NF
    CD81 cDNA ORF Clone, Rat, C-His tag RG80331-CH
    CD81 cDNA ORF Clone, Rat, N-His tag RG80331-NH
    CD81 cDNA ORF Clone, Rat, C-HA tag RG80331-CY
    CD81 cDNA ORF Clone, Rat, N-HA tag RG80331-NY
    CD81 cDNA ORF Clone, Rat, C-Myc tag RG80331-CM
    CD81 cDNA ORF Clone, Rat, N-Myc tag RG80331-NM
    CD81 qPCR Primer Pairs, Rat RP300301

    CD81 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD81 cDNA ORF Clone in Cloning Vector, Mouse MG50743-G
    CD81 cDNA ORF Clone, Mouse, untagged MG50743-UT
    CD81 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50743-ACG
    CD81 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50743-ACGLN
    CD81 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50743-ACR
    CD81 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50743-CF
    CD81 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50743-NF
    CD81 cDNA ORF Clone, Mouse, C-His tag MG50743-CH
    CD81 cDNA ORF Clone, Mouse, N-His tag MG50743-NH
    CD81 cDNA ORF Clone, Mouse, C-HA tag MG50743-CY
    CD81 cDNA ORF Clone, Mouse, N-HA tag MG50743-NY
    CD81 cDNA ORF Clone, Mouse, C-Myc tag MG50743-CM
    CD81 cDNA ORF Clone, Mouse, N-Myc tag MG50743-NM
    CD81 qPCR Primer Pairs, Mouse MP200718

    CD81 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD81 cDNA ORF Clone in Cloning Vector, Human HG14244-G
    CD81 cDNA ORF Clone, Human, untagged HG14244-UT
    CD81 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14244-ACGLN
    CD81 cDNA ORF Clone, Human, C-GFPSpark® tag HG14244-ACG
    CD81 cDNA ORF Clone, Human, C-OFPSpark® tag HG14244-ACR
    CD81 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14244-CF
    CD81 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14244-NF
    CD81 cDNA ORF Clone, Human, C-His tag HG14244-CH
    CD81 cDNA ORF Clone, Human, N-His tag HG14244-NH
    CD81 cDNA ORF Clone, Human, C-HA tag HG14244-CY
    CD81 cDNA ORF Clone, Human, N-HA tag HG14244-NY
    CD81 cDNA ORF Clone, Human, C-Myc tag HG14244-CM
    CD81 cDNA ORF Clone, Human, N-Myc tag HG14244-NM
    CD81 qPCR Primer Pairs, Human HP102894
    info info
    添加购物车成功! 添加购物车失败!