B7-1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag

Cat: CG90268-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All B7-1 Reagents
CRO Services
Product recommended

All B7-1 Reagents
B7-1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
867 bp
Description
Full length Clone DNA of Rhesus CD80 molecule with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

B7-1 Background Information

The B-lymphocyte activation antigen B7-1 (referred to as B7), also known as CD80, is a member of cell surface immunoglobulin superfamily and is expressed on the surface of antigen-presenting cells including activated B cells, macrophages and dendritic cells. As costimulatory ligands, B7-1 which exists predominantly as dimer and the related protein B7-2, interact with the costimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus constitute one of the dominant pathways that regulate T cell activation and tolerance, cytokine production, and the generation of CTL. The B7/CD28/CTLA4 pathway has the ability to both positively and negatively regulate immune responses. CD80 is thus regarded as promising therapeutic targets for autoimmune diseases and various carcinomas.

Immune Checkpoint
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD80 molecule
References
  • Greenfield EA, et al. (1998) CD28/B7 costimulation: a review. Crit Rev Immunol. 18(5): 389-418.
  • Zang X, et al. (2007) The B7 family and cancer therapy: costimulation and coinhibition. Clin Cancer Res. 13(18 Pt 1): 5271-9.
  • Mir MA, et al. (2008) Signaling through CD80: an approach for treating lymphomas. Expert Opin Ther Targets. 12(8): 969-79.
  • B7-1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    B7-1 cDNA ORF Clone in Cloning Vector, Rhesus CG90268-G
    B7-1 cDNA ORF Clone, Rhesus, untagged CG90268-UT
    B7-1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90268-ACGLN
    B7-1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90268-ACG
    B7-1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90268-ACR
    B7-1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90268-NF
    B7-1 cDNA ORF Clone, Rhesus, C-His tag CG90268-CH
    B7-1 cDNA ORF Clone, Rhesus, N-His tag CG90268-NH
    B7-1 cDNA ORF Clone, Rhesus, C-HA tag CG90268-CY
    B7-1 cDNA ORF Clone, Rhesus, N-HA tag CG90268-NY
    B7-1 cDNA ORF Clone, Rhesus, C-Myc tag CG90268-CM
    B7-1 cDNA ORF Clone, Rhesus, N-Myc tag CG90268-NM

    B7-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    B7-1 cDNA ORF Clone in Cloning Vector, Rat RG80027-M
    B7-1 cDNA ORF Clone, Rat, untagged RG80027-UT
    B7-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80027-ACG
    B7-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80027-ACGLN
    B7-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80027-ACR
    B7-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80027-CF
    B7-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80027-NF
    B7-1 cDNA ORF Clone, Rat, C-His tag RG80027-CH
    B7-1 cDNA ORF Clone, Rat, N-His tag RG80027-NH
    B7-1 cDNA ORF Clone, Rat, C-HA tag RG80027-CY
    B7-1 cDNA ORF Clone, Rat, N-HA tag RG80027-NY
    B7-1 cDNA ORF Clone, Rat, C-Myc tag RG80027-CM
    B7-1 cDNA ORF Clone, Rat, N-Myc tag RG80027-NM
    B7-1 qPCR Primer Pairs, Rat RP300026

    B7-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    B7-1 cDNA ORF Clone in Cloning Vector, Mouse MG50446-G
    B7-1 cDNA ORF Clone, Mouse, untagged MG50446-UT
    B7-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50446-ACGLN
    B7-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50446-ACG
    B7-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50446-ACR
    B7-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50446-CF
    B7-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50446-NF
    B7-1 cDNA ORF Clone, Mouse, C-His tag MG50446-CH
    B7-1 cDNA ORF Clone, Mouse, N-His tag MG50446-NH
    B7-1 cDNA ORF Clone, Mouse, C-HA tag MG50446-CY
    B7-1 cDNA ORF Clone, Mouse, N-HA tag MG50446-NY
    B7-1 cDNA ORF Clone, Mouse, C-Myc tag MG50446-CM
    B7-1 cDNA ORF Clone, Mouse, N-Myc tag MG50446-NM
    B7-1 qPCR Primer Pairs, Mouse MP200455

    B7-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    B7-1 cDNA ORF Clone in Cloning Vector, Human HG10698-G
    B7-1 cDNA ORF Clone, Human, untagged HG10698-UT
    B7-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10698-ACGLN
    B7-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10698-ACG
    B7-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10698-ACR
    B7-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10698-CF
    B7-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10698-NF
    B7-1 cDNA ORF Clone, Human, C-His tag HG10698-CH
    B7-1 cDNA ORF Clone, Human, N-His tag HG10698-NH
    B7-1 cDNA ORF Clone, Human, C-HA tag HG10698-CY
    B7-1 cDNA ORF Clone, Human, N-HA tag HG10698-NY
    B7-1 cDNA ORF Clone, Human, C-Myc tag HG10698-CM
    B7-1 cDNA ORF Clone, Human, N-Myc tag HG10698-NM
    B7-1 qPCR Primer Pairs, Human HP100652
    info info
    添加购物车成功! 添加购物车失败!