Text Size:AAA

Rhesus CD80/B7-1 Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Cynomolgus CD80 cDNA Clone Product Information
    NCBI RefSeq:NM_001042642.1
    RefSeq ORF Size:867bp
    cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) CD80 molecule with C terminal Flag tag.
    Gene Synonym:B7.1, CD80
    Species:Rhesus
    Vector:pCMV3-C-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    The B-lymphocyte activation antigen B7-1 (referred to as B7), also known as CD80, is a member of cell surface immunoglobulin superfamily and is expressed on the surface of antigen-presenting cells including activated B cells, macrophages and dendritic cells. As costimulatory ligands, B7-1 which exists predominantly as dimer and the related protein B7-2, interact with the costimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus constitute one of the dominant pathways that regulate T cell activation and tolerance, cytokine production, and the generation of CTL. The B7/CD28/CTLA4 pathway has the ability to both positively and negatively regulate immune responses. CD80 is thus regarded as promising therapeutic targets for autoimmune diseases and various carcinomas.

    Immune Checkpoint
    Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: FCM Antibodies   Immune Checkpoint Detection: WB Antibodies
    Immune Checkpoint Proteins
    Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Greenfield EA, et al. (1998) CD28/B7 costimulation: a review. Crit Rev Immunol. 18(5): 389-418.
  • Zang X, et al. (2007) The B7 family and cancer therapy: costimulation and coinhibition. Clin Cancer Res. 13(18 Pt 1): 5271-9.
  • Mir MA, et al. (2008) Signaling through CD80: an approach for treating lymphomas. Expert Opin Ther Targets. 12(8): 969-79.
  • Size / Price
    Catalog: CG90268-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"