Text Size:AAA

Rhesus CD64/Fc gamma RI Gene ORF cDNA clone expression plasmid, C-GFPSpark tag

  • Cynomolgus monkey CD64 / FCGR1 natural ORF mammalian expression plasmid, C-GFPSpark tag
  • Cynomolgus monkey CD64 / FCGR1 natural ORF mammalian expression plasmid, C-GFPSpark tag
DatasheetReviewsRelated ProductsProtocols
Rhesus FCGR1 cDNA Clone Product Information
NCBI RefSeq:JQ037994.2
RefSeq ORF Size:1074bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) high affinity immunoglobulin gamma Fc receptor I with C terminal GFPSpark tag.
Gene Synonym:FCGR1
Species:Rhesus
Vector:pCMV3-C-GFPSpark
Plasmid:pCMV3-cynoFCGR1-GFPSpark
Restriction Site:KpnI + XbaI (6kb + 1.80kb)
Tag Sequence:GFPSpark: GTGAGCAAGGGC……GAGCTGTACAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence. Please check the sequence information before order.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Rhesus FCGR1 Gene Plasmid Map
Cynomolgus monkey CD64 / FCGR1 natural ORF mammalian expression plasmid, C-GFPSpark tag
Rhesus FCGR1 Gene Expression validated Image
Cynomolgus monkey CD64 / FCGR1 natural ORF mammalian expression plasmid, C-GFPSpark tag
[Click to enlarge image]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat#STF01) transiently. After 48 h, the fluorescent signals can be detected by fluorescence microscope. Green excitation 475/40nm, emission 535/45nm. Red excitation 560/55nm, emission 645/45nm. Orange excitation 525/45nm, emission 595/60nm.
GFPSpark Tag Info

GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Product nameProduct name
Background

High affinity immunoglobulin gamma Fc receptor I, also known as FCGR1 and CD64, is an integral membrane glycoprotein and a member of the immunoglobulin superfamily. CD64 is a high affinity receptor for the Fc region of IgG gamma and functions in both innate and adaptive immune responses. Receptors that recognize the Fc portion of IgG function in the regulation of immune response and are divided into three classes designated CD64, CD32, and CD16. CD64 is structurally composed of a signal peptide that allows its transport to the surface of a cell, three extracellular immunoglobulin domains of the C2-type that it uses to bind antibody, a hydrophobic transmembrane domain, and a short cytoplasmic tail. CD64 is constitutively found on only macrophages and monocytes, but treatment of polymorphonuclear leukocytes with cytokines like IFNγ and G-CSF can induce CD64 expression on these cells. The inactivation of the mouse CD64 resulted in a wide range of defects in antibody Fc-dependent functions. Mouse CD64 is an early participant in Fc-dependent cell activation and in the development of immune responses.

Size / Price
Catalog: CG90017-ACG
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"