CD300LB cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag

Cat: CG90264-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CD300LB Reagents
CRO Services
Product recommended

All CD300LB Reagents
CD300LB cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
717 bp
Description
Full length Clone DNA of Rhesus CD300 molecule-like family member b with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD300LB Background Information
Full Name
CD300 molecule-like family member b

CD300LB cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CD300LB cDNA ORF Clone in Cloning Vector, Rhesus CG90264-G
CD300LB cDNA ORF Clone, Rhesus, untagged CG90264-UT
CD300LB cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90264-ACG
CD300LB Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90264-ACGLN
CD300LB cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90264-ACR
CD300LB cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90264-NF
CD300LB cDNA ORF Clone, Rhesus, C-His tag CG90264-CH
CD300LB cDNA ORF Clone, Rhesus, N-His tag CG90264-NH
CD300LB cDNA ORF Clone, Rhesus, C-HA tag CG90264-CY
CD300LB cDNA ORF Clone, Rhesus, N-HA tag CG90264-NY
CD300LB cDNA ORF Clone, Rhesus, C-Myc tag CG90264-CM
CD300LB cDNA ORF Clone, Rhesus, N-Myc tag CG90264-NM

CD300LB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CD300LB cDNA ORF Clone in Cloning Vector, Human HG13650-G
CD300LB cDNA ORF Clone, Human, untagged HG13650-UT
CD300LB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13650-ACGLN
CD300LB cDNA ORF Clone, Human, C-GFPSpark® tag HG13650-ACG
CD300LB cDNA ORF Clone, Human, C-OFPSpark® tag HG13650-ACR
CD300LB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13650-CF
CD300LB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13650-NF
CD300LB cDNA ORF Clone, Human, C-His tag HG13650-CH
CD300LB cDNA ORF Clone, Human, N-His tag HG13650-NH
CD300LB cDNA ORF Clone, Human, C-HA tag HG13650-CY
CD300LB cDNA ORF Clone, Human, N-HA tag HG13650-NY
CD300LB cDNA ORF Clone, Human, C-Myc tag HG13650-CM
CD300LB cDNA ORF Clone, Human, N-Myc tag HG13650-NM
CD300LB qPCR Primer Pairs, Human HP102333
info info
添加购物车成功! 添加购物车失败!