After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rhesus CCL24/Eotaxin-2/MPIF-2 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus CCL24 cDNA Clone Product Information
NCBI RefSeq:NM_001194459.1
RefSeq ORF Size:360bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) chemokine (C-C motif) ligand 24 with N terminal Myc tag.
Gene Synonym:CCL24
Species:Rhesus
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CCL24, also known as Eotaxin-2 and MPIF-2, belongs to the intercrine beta (chemokine CC) family. CCL24 gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. CCL24 displays chemotactic activity on resting T lymphocytes, a minimal activity on neutrophils, and is negative on monocytes and activated T lymphocytes. CCL24 is also a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. CCL24 is chemotactic for resting T-lymphocytes, and eosinophils. It has lower chemotactic activity for neutrophils but none for monocytes and activated lymphocytes. It is a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. Eotaxin-2 interacts with chemokine receptor CCR3 to induce chemotaxis in eosinophils. Elevated level of Eotaxin-2 has been seen in patients with aspirin-exacerbated respiratory disease.

References
  • Manousou P, et al. (2010) Increased expression of chemokine receptor CCR3 and its ligands in ulcerative colitis: the role of colonic epithelial cells in in vitro studies. Clin Exp Immunol. 162 (2): 337-47.
  • Owczarek W, et al. (2010) Analysis of eotaxin 1/CCL11, eotaxin 2/CCL24 and eotaxin 3/CCL26 expression in lesional and non-lesional skin of patients with atopic dermatitis. Cytokine. 50 (2): 181-5.
  • Luesink M, et al. (2009) Chemokine induction by all-trans retinoic acid and arsenic trioxide in acute promyelocytic leukemia: triggering the differentiation syndrome. Blood. 114 (27): 5512-21.
  • Size / Price
    Catalog: CG90131-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"