Quick Order

Rhesus Carbonic Anhydrase X Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus CA10 cDNA Clone Product Information
NCBI RefSeq:NM_001266383.1
RefSeq ORF Size:987bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) carbonic anhydrase X with N terminal HA tag.
Gene Synonym:CA10
Species:Rhesus
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Carbonic anhydrase X, also called carbonic anhydrase - related protein X (CARPX) and CA10, belongs to the CA family of zinc metalloenzymes which catalyze the reversible hydration of carbon dioxide in various biological processes such as respiration, renal tubular acidification and bone resorption. The secreted protein CARPX without CA activity (hydration of CO2) is identified as an acatalytic member of the alpha-carbonic anhydrase subgroup. CARP X expression is detected in the adult total brain and almost all parts of the central nervous system, but not in the fetal brain. Accordingly, CARP X is suggested to play a role in the development of central nervous system, especially the brain. The same CARP X protein are encoded by multiple transcript variants of this gene.

References
  • Okamoto, N. et al., 2001, Biochim. Biophys. Acta 1518:311-316.
  • Taniuchi, K. et al., Neuroscience 112: 93-99.
  • Supuran, C.T. et al., 2003, Med. Res. Rev. 23: 146-189.
  • Size / Price
    Catalog: CG90489-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"