Quick Order

Rhesus Carbonic Anhydrase X Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus CA10 cDNA Clone Product Information
NCBI RefSeq:NM_001266383.1
RefSeq ORF Size:987bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) carbonic anhydrase X with N terminal Flag tag.
Gene Synonym:CA10
Species:Rhesus
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Carbonic anhydrase X, also called carbonic anhydrase - related protein X (CARPX) and CA10, belongs to the CA family of zinc metalloenzymes which catalyze the reversible hydration of carbon dioxide in various biological processes such as respiration, renal tubular acidification and bone resorption. The secreted protein CARPX without CA activity (hydration of CO2) is identified as an acatalytic member of the alpha-carbonic anhydrase subgroup. CARP X expression is detected in the adult total brain and almost all parts of the central nervous system, but not in the fetal brain. Accordingly, CARP X is suggested to play a role in the development of central nervous system, especially the brain. The same CARP X protein are encoded by multiple transcript variants of this gene.

References
  • Okamoto, N. et al., 2001, Biochim. Biophys. Acta 1518:311-316.
  • Taniuchi, K. et al., Neuroscience 112: 93-99.
  • Supuran, C.T. et al., 2003, Med. Res. Rev. 23: 146-189.
  • Size / Price
    Catalog: CG90489-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"