Quick Order

Rhesus BTLA/CD272 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus BTLA cDNA Clone Product Information
NCBI RefSeq:XM_001104281.2
RefSeq ORF Size:870bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) b- and T-lymphocyte attenuator-like with C terminal Flag tag.
Gene Synonym:BTLA
Species:Rhesus
Vector:pCMV3-C-FLAG
Plasmid:pCMV3-cynoBTLA-Flag
Restriction Site:KpnI + XbaI (6kb + 0.91kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 333 C/G and 642 G/A not causing the amino acid variation. Please check the sequence information before order.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Cynomolgus BTLA Gene Plasmid Map
Cynomolgus monkey BTLA natural ORF mammalian expression plasmid, C-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

BTLA is a inhibitory molecule which belongs to the Ig superfamily. It down-modulates immune responses. As such, reagents that regulate the binding of BTLA to its ligand or alter BTLA signaling have significant therapeutic promise. BTLA is crucial to understand the mechanism(s) of action of these antibodies before attempting clinical applications. BTLA is not expressed by naive T cells, but it is induced during activation and remains expressed on T helper type 1 (T(H)1) but not T(H)2 cells. BTLA is a third inhibitory receptor on T lymphocytes with similarities to cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) and programmed death 1 (PD-1).

References
  • Fourcade J, et al. (2012) CD8(+) T cells specific for tumor antigens can be rendered dysfunctional by the tumor microenvironment through upregulation of the inhibitory receptors BTLA and PD-1. Cancer Res. 72(4):887-96.
  • Kojima R, et al. (2011) Molecular basis for herpesvirus entry mediator recognition by the human immune inhibitory receptor CD160 and its relationship to the cosignaling molecules BTLA and LIGHT. J Mol Biol. 413(4):762-72.
  • Oki M, et al. (2011) A functional polymorphism in B and T lymphocyte attenuator is associated with susceptibility to rheumatoid arthritis. Clin Dev Immunol. 305656.
  • Size / Price
    Catalog: CG90250-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Cynomolgus monkey BTLA natural ORF mammalian expression plasmid, C-Flag tag
    • Human DAZL ORF mammalian expression plasmid, C-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"