CD147 cDNA ORF Clone, Cynomolgus, N-His tag

Cat: CG90636-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD147 Reagents
CRO Services
Product recommended

All CD147 Reagents
CD147 cDNA ORF Clone, Cynomolgus, N-His tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
822 bp
Description
Full length Clone DNA of Cynomolgus basigin (Ok blood group) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD147 Background Information

CD147/EMMPRIN (Extracellular Matrix Metalloproteinase Inducer), also known as Basigin (BSG), is a transmembrane glycoprotein with different forms resulted from different modes of glycosylation and N-terminal sequence variants. It is a member of the immunoglobulin superfamily with homology to both the immunoglobulin V domain and MHC class II antigen beta-chain. This protein play important roles in variety of events including spermatogenesis, embryo implantation, neural network formation. CD147 induces the production and release of matrix metalloproteinases (MMP) in the surrounding mesenchymal cells and tumor cells, and thereby promotes invasion, metastasis, growth and survival of malignant cells. Furthermore, CD147 also serves as a receptor for extracellular cyclophilinthe and its association with integrins might be important in signal transduction. Recently, CD147 displays increased expression in many cancers, and it has been previously demonstrated to participate in cancer metastasis and progression. Thus, CD147 and its antibody are used as an effective treatment for malignant cancers.

Full Name
basigin (Ok blood group)
References
  • Tang Y, et al. (2004) Tumor-stroma interaction: positive feedback regulation of extracellular matrix metalloproteinase inducer (EMMPRIN) expression and matrix metalloproteinase-dependent generation of soluble EMMPRIN. Mol Cancer Res. 2(2): 73-80.
  • Wilson MC, et al. (2005) Basigin (CD147) is the target for organomercurial inhibition of monocarboxylate transporter isoforms 1 and 4: the ancillary protein for the insensitive MCT2 is EMBIGIN (gp70). J Biol Chem. 280(29): 27213-21.
  • Curtin KD, et al. (2005) Basigin (EMMPRIN/CD147) interacts with integrin to affect cellular architecture. J Cell Sci. 118(Pt 12): 2649-60.
  • Zhu H, et al. (2009) A novel antibody fragment targeting HAb18G/CD147 with cytotoxicity and decreased immunogenicity. Cancer Biol Ther. 8(11): 1035-44. Zhu H, et al. (2009) A novel antibody fragment targeting HAb18G/CD147 with cytotoxicity and decreased immunogenicity. Cancer Biol Ther. 8(11): 1035-44.
  • Seizer P, et al. (2009) EMMPRIN (CD147) is a novel receptor for platelet GPVI and mediates platelet rolling via GPVI-EMMPRIN interaction. Thromb Haemost. 101(4): 682-6.
  • Moonsom S, et al. (2010) A Competitive ELISA for Quantifying Serum CD147: Reduction of Soluble CD147 Levels in Cancer Patient Sera. Hybridoma (Larchmt). 29(1): 45-52.
  • CD147 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    CD147 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90636-G
    CD147 cDNA ORF Clone, Cynomolgus, untagged CG90636-UT
    CD147 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90636-ACG
    CD147 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90636-ACGLN
    CD147 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90636-ACR
    CD147 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90636-CF
    CD147 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90636-NF
    CD147 cDNA ORF Clone, Cynomolgus, C-His tag CG90636-CH
    CD147 cDNA ORF Clone, Cynomolgus, C-HA tag CG90636-CY
    CD147 cDNA ORF Clone, Cynomolgus, N-HA tag CG90636-NY
    CD147 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90636-CM
    CD147 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90636-NM

    CD147 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD147 cDNA ORF Clone in Cloning Vector, Rat RG82193-U
    CD147 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82193-ACGLN

    CD147 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD147 cDNA ORF Clone in Cloning Vector, Mouse MG50332-M
    CD147 cDNA ORF Clone, Mouse, untagged MG50332-UT
    CD147 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50332-ACGLN
    CD147 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50332-ACG
    CD147 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50332-ACR
    CD147 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50332-CF
    CD147 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50332-NF
    CD147 cDNA ORF Clone, Mouse, C-His tag MG50332-CH
    CD147 cDNA ORF Clone, Mouse, N-His tag MG50332-NH
    CD147 cDNA ORF Clone, Mouse, C-HA tag MG50332-CY
    CD147 cDNA ORF Clone, Mouse, N-HA tag MG50332-NY
    CD147 cDNA ORF Clone, Mouse, C-Myc tag MG50332-CM
    CD147 cDNA ORF Clone, Mouse, N-Myc tag MG50332-NM
    CD147 qPCR Primer Pairs, Mouse MP200355

    CD147 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD147 cDNA ORF Clone in Cloning Vector, Human HG10186-M
    CD147 cDNA ORF Clone, Human, untagged HG10186-UT
    CD147 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10186-ACGLN
    CD147 cDNA ORF Clone, Human, C-GFPSpark® tag HG10186-ACG
    CD147 cDNA ORF Clone, Human, C-OFPSpark® tag HG10186-ACR
    CD147 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10186-CF
    CD147 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10186-NF
    CD147 cDNA ORF Clone, Human, C-His tag HG10186-CH
    CD147 cDNA ORF Clone, Human, N-His tag HG10186-NH
    CD147 cDNA ORF Clone, Human, C-HA tag HG10186-CY
    CD147 cDNA ORF Clone, Human, N-HA tag HG10186-NY
    CD147 cDNA ORF Clone, Human, C-Myc tag HG10186-CM
    CD147 cDNA ORF Clone, Human, N-Myc tag HG10186-NM
    CD147 qPCR Primer Pairs, Human HP100032
    info info
    添加购物车成功! 添加购物车失败!