BMPR2 cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90065-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BMPR2 Reagents
CRO Services
Product recommended

All BMPR2 Reagents
BMPR2 cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
3117 bp
Description
Full length Clone DNA of Rhesus bone morphogenetic protein receptor, type II (serine/threonine kinase) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BMPR2 Background Information

The bone morphogenetic protein type II receptor (BMPR-II, or BMPR2), a receptor for the transforming growth factor (TGF)-beta/bone morphogenetic protein (BMP) superfamily. Reduced expression or function of BMPR2 signaling leads to exaggerated TGF-beta signaling and altered cellular responses to TGF-beta. In endothelial cells, BMPR2 mutation increases the susceptibility of cells to apoptosis. BMPR2 transduces BMP signals by forming heteromeric complexes with and phosphorylating BMP type I receptors. The intracellular domain of BMPR2 is both necessary and sufficient for receptor complex interaction. It had been identified that BMPR2 plays a key role in cell growth. Its mutations lead to hereditary pulmonary hypertension, and knockout of Bmpr-II results in early embryonic lethality. The C-terminal tail of BMPR2 provides binding sites for a number of regulatory proteins that may initiate Smad-independent signalling. BMPR2 mutations were predicted to alter the BMP and TGF-b1/SMAD signalling pathways, resulting in proliferation rather than apoptosis of vascular cells, and greatly increase the risk of developing severe pulmonary arterial hypertension. BMPR2 gene result in familial Primary pulmonary hypertension (PPH) transmitted as an autosomal dominant trait, albeit with low penetrance. Heterozygous germline mutations of BMPR2 gene have been identified in patients with familial and sporadic PPH, indicating that BMPR2 may contribute to the maintenance of normal pulmonary vascular structure and function. Tctex-1, a light chain of the motor complex dynein, interacts with the cytoplasmic domain of BMPR2 and demonstrate that Tctex-1 is phosphorylated by BMPR-II, a function disrupted by PPH disease causing mutations within exon 12. BMPR2 and Tctex-1 co-localize to endothelium and smooth muscle within the media of pulmonary arterioles, key sites of vascular remodelling in PPH.

Full Name
bone morphogenetic protein receptor, type II (serine/threonine kinase)
References
  • Machado RD, et al. (2003) Functional interaction between BMPR-II and Tctex-1, a light chain of Dynein, is isoform-specific and disrupted by mutations underlying primary pulmonary hypertension. Hum Mol Genet. 12(24): 3277-86.
  • Abramowicz MJ, et al. (2003) Primary pulmonary hypertension after amfepramone (diethylpropion) with BMPR2 mutation. Eur Respir J. 22(3): 560-2.
  • Hassel S, et al. (2004) Proteins associated with type II bone morphogenetic protein receptor (BMPR-II) and identified by two-dimensional gel electrophoresis and mass spectrometry. Proteomics. 4(5): 1346-58.
  • Beppu H, et al. (2005) Generation of a floxed allele of the mouse BMP type II receptor gene. Genesis. 41(3): 133-7.
  • Morrell NW. (2006) Pulmonary hypertension due to BMPR2 mutation: a new paradigm for tissue remodeling? Proc Am Thorac Soc. 3(8): 680-6.
  • Nasim MT, et al. (2008) Stoichiometric imbalance in the receptor complex contributes to dysfunctional BMPR-II mediated signalling in pulmonary arterial hypertension. Hum Mol Genet. 217(11): 1683-94.
  • BMPR2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    BMPR2 cDNA ORF Clone in Cloning Vector, Rhesus CG90065-G
    BMPR2 cDNA ORF Clone, Rhesus, untagged CG90065-UT
    BMPR2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90065-ACG
    BMPR2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90065-ACGLN
    BMPR2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90065-ACR
    BMPR2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90065-CF
    BMPR2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90065-NF
    BMPR2 cDNA ORF Clone, Rhesus, C-His tag CG90065-CH
    BMPR2 cDNA ORF Clone, Rhesus, N-His tag CG90065-NH
    BMPR2 cDNA ORF Clone, Rhesus, C-HA tag CG90065-CY
    BMPR2 cDNA ORF Clone, Rhesus, N-HA tag CG90065-NY
    BMPR2 cDNA ORF Clone, Rhesus, C-Myc tag CG90065-CM

    BMPR2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BMPR2 cDNA ORF Clone, Mouse, untagged MG57615-UT

    BMPR2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BMPR2 cDNA ORF Clone in Cloning Vector, Human HG10551-M
    BMPR2 cDNA ORF Clone, Human, untagged HG10551-UT
    BMPR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10551-ACG
    BMPR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10551-ACGLN
    BMPR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10551-ACR
    BMPR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10551-CF
    BMPR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10551-NF
    BMPR2 cDNA ORF Clone, Human, C-His tag HG10551-CH
    BMPR2 cDNA ORF Clone, Human, N-His tag HG10551-NH
    BMPR2 cDNA ORF Clone, Human, C-HA tag HG10551-CY
    BMPR2 cDNA ORF Clone, Human, N-HA tag HG10551-NY
    BMPR2 cDNA ORF Clone, Human, C-Myc tag HG10551-CM
    BMPR2 cDNA ORF Clone, Human, N-Myc tag HG10551-NM
    BMPR2 qPCR Primer Pairs, Human HP100565
    info info
    添加购物车成功! 添加购物车失败!