BMPR1A cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90064-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BMPR1A Reagents
CRO Services
Product recommended

All BMPR1A Reagents
BMPR1A cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1599 bp
Description
Full length Clone DNA of Rhesus bone morphogenetic protein receptor, type IA with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BMPR1A Background Information

Activin receptor-Like Kinase 3 (ALK-3), also known as Bone Morphogenetic Protein Receptor, type IA (BMPR1A), is a type I receptor for bone morphogenetic proteins (BMPs) which belong to the transforming growth factor beta (TGF-β) superfamily. The BMP receptors form a subfamily of transmembrane serine/threonine kinases including the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. ALK-3/BMPR1A is expressed in the epithelium during branching morphogenesis. Deletion of BMPR1A in the epithelium with an Sftpc-cre transgene leads to dramatic defects in lung development. ALK-3 and ALK-6 share a high degree of homology, yet possess distinct signaling roles. The transforming growth factor (TGF)-beta type III receptor (TbetaRIII) enhanced both ALK-3 and ALK-6 signaling. TbetaRIII associated with ALK-3 primarily through their extracellular domains, whereas its interaction with ALK-6 required both the extracellular and cytoplasmic domains. ALK-3 plays an essential role in the formation of embryonic ventral abdominal wall, and abrogation of BMP signaling activity due to gene mutations in its signaling components could be one of the underlying causes of omphalocele at birth. The type IA BMP receptor, ALK-3 was specifically required at mid-gestation for normal development of the trabeculae, compact myocardium, interventricular septum, and endocardial cushion. Cardiac muscle lacking ALK-3 was specifically deficient in expressing TGFbeta2, an established paracrine mediator of cushion morphogenesis. Hence, ALK-3 is essential, beyond just the egg cylinder stage, for myocyte-dependent functions and signals in cardiac organogenesis.

Full Name
bone morphogenetic protein receptor, type IA
References
  • Gaussin V, et al. (2002) Endocardial cushion and myocardial defects after cardiac myocyte-specific conditional deletion of the bone morphogenetic protein receptor ALK3. Proc Natl Acad Sci U S A. 99(5): 2878-83.
  • Eblaghie MC, et al. (2006) Evidence that autocrine signaling through Bmpr1a regulates the proliferation, survival and morphogenetic behavior of distal lung epithelial cells. Dev Biol. 291(1): 67-82.
  • Sun J, et al. (2007) Deficient Alk3-mediated BMP signaling causes prenatal omphalocele-like defect. Biochem Biophys Res Commun. 360(1): 238-43.
  • Lee NY, et al. (2009) The transforming growth factor-beta type III receptor mediates distinct subcellular trafficking and downstream signaling of activin-like kinase (ALK)3 and ALK6 receptors. Mol Biol Cell. 20(20): 4362-70.
  • BMPR1A cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    BMPR1A cDNA ORF Clone in Cloning Vector, Canine DG70051-G
    BMPR1A cDNA ORF Clone, Canine, untagged DG70051-UT
    BMPR1A cDNA ORF Clone, Canine, C-GFPSpark® tag DG70051-ACG
    BMPR1A Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70051-ACGLN
    BMPR1A cDNA ORF Clone, Canine, C-OFPSpark® tag DG70051-ACR
    BMPR1A cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70051-CF
    BMPR1A cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70051-NF
    BMPR1A cDNA ORF Clone, Canine, C-His tag DG70051-CH
    BMPR1A cDNA ORF Clone, Canine, N-His tag DG70051-NH
    BMPR1A cDNA ORF Clone, Canine, C-HA tag DG70051-CY
    BMPR1A cDNA ORF Clone, Canine, N-HA tag DG70051-NY
    BMPR1A cDNA ORF Clone, Canine, C-Myc tag DG70051-CM
    BMPR1A cDNA ORF Clone, Canine, N-Myc tag DG70051-NM

    BMPR1A cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    BMPR1A cDNA ORF Clone in Cloning Vector, Rhesus CG90064-G
    BMPR1A cDNA ORF Clone, Rhesus, untagged CG90064-UT
    BMPR1A cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90064-ACG
    BMPR1A Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90064-ACGLN
    BMPR1A cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90064-ACR
    BMPR1A cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90064-CF
    BMPR1A cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90064-NF
    BMPR1A cDNA ORF Clone, Rhesus, C-His tag CG90064-CH
    BMPR1A cDNA ORF Clone, Rhesus, C-HA tag CG90064-CY
    BMPR1A cDNA ORF Clone, Rhesus, N-HA tag CG90064-NY
    BMPR1A cDNA ORF Clone, Rhesus, C-Myc tag CG90064-CM
    BMPR1A cDNA ORF Clone, Rhesus, N-Myc tag CG90064-NM

    BMPR1A cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    BMPR1A cDNA ORF Clone in Cloning Vector, Rat RG80138-G
    BMPR1A cDNA ORF Clone, Rat, untagged RG80138-UT
    BMPR1A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80138-ACGLN
    BMPR1A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80138-ACG
    BMPR1A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80138-ACR
    BMPR1A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80138-CF
    BMPR1A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80138-NF
    BMPR1A cDNA ORF Clone, Rat, C-His tag RG80138-CH
    BMPR1A cDNA ORF Clone, Rat, N-His tag RG80138-NH
    BMPR1A cDNA ORF Clone, Rat, C-HA tag RG80138-CY
    BMPR1A cDNA ORF Clone, Rat, N-HA tag RG80138-NY
    BMPR1A cDNA ORF Clone, Rat, C-Myc tag RG80138-CM
    BMPR1A cDNA ORF Clone, Rat, N-Myc tag RG80138-NM
    BMPR1A qPCR Primer Pairs, Rat RP300134

    BMPR1A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BMPR1A cDNA ORF Clone in Cloning Vector, Mouse MG50078-M
    BMPR1A cDNA ORF Clone, Mouse, untagged MG50078-UT
    BMPR1A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50078-ACGLN
    BMPR1A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50078-ACG
    BMPR1A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50078-ACR
    BMPR1A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50078-CF
    BMPR1A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50078-NF
    BMPR1A cDNA ORF Clone, Mouse, C-His tag MG50078-CH
    BMPR1A cDNA ORF Clone, Mouse, N-His tag MG50078-NH
    BMPR1A cDNA ORF Clone, Mouse, C-HA tag MG50078-CY
    BMPR1A cDNA ORF Clone, Mouse, N-HA tag MG50078-NY
    BMPR1A cDNA ORF Clone, Mouse, C-Myc tag MG50078-CM
    BMPR1A cDNA ORF Clone, Mouse, N-Myc tag MG50078-NM
    BMPR1A qPCR Primer Pairs, Mouse MP200109

    BMPR1A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BMPR1A cDNA ORF Clone in Cloning Vector, Human HG10446-M
    BMPR1A cDNA ORF Clone, Human, untagged HG10446-UT
    BMPR1A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10446-ACGLN
    BMPR1A cDNA ORF Clone, Human, C-GFPSpark® tag HG10446-ACG
    BMPR1A cDNA ORF Clone, Human, C-OFPSpark® tag HG10446-ACR
    BMPR1A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10446-CF
    BMPR1A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10446-NF
    BMPR1A cDNA ORF Clone, Human, C-His tag HG10446-CH
    BMPR1A cDNA ORF Clone, Human, N-His tag HG10446-NH
    BMPR1A cDNA ORF Clone, Human, C-HA tag HG10446-CY
    BMPR1A cDNA ORF Clone, Human, N-HA tag HG10446-NY
    BMPR1A cDNA ORF Clone, Human, C-Myc tag HG10446-CM
    BMPR1A cDNA ORF Clone, Human, N-Myc tag HG10446-NM
    BMPR1A qPCR Primer Pairs, Human HP100475
    info info
    添加购物车成功! 添加购物车失败!