BMP5 cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90053-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BMP5 Reagents
CRO Services
Product recommended

All BMP5 Reagents
BMP5 cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1365 bp
Description
Full length Clone DNA of Rhesus bone morphogenetic protein 5 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BMP5 Background Information

Bone Morphogenetic Protein 5 (BMP-5) is a member of the structurally and functionally related bone morphogenetic proteins (BMPs) which constitute a novel subfamily of the transforming growth factor β (TGF-β) superfamily. In agreement with a possible role in the control of cell death, BMP-5 exhibited a regulated pattern of expression in the interdigital tissue. Transcripts of BMP-5 and BMP-5 protein were abundant within the cytoplasm of the fragmenting apoptotic interdigital cells in a way suggesting that delivery of BMPs into the tissue is potentiated during apoptosis. Gain-of-function experiments demonstrated that BMP-5 has the same effect as other interdigital BMPs inducing apoptosis in the undifferentiated mesoderm and growth in the prechondrogenic mesenchyme. BMP-5 is a member of the 60A subgroup of BMPs, other members of which have been shown to stimulate dendritic growth in central and peripheral neurons. The signaling pathway that mediates the dendrite-promoting activity of BMP-5 may involve binding to BMPR-IA and activation of Smad-1, and relative levels of BMP antagonists such as noggin and follistatin may modulate BMP-5 signaling. Since BMP-5 is expressed at relatively high levels not only in the developing but also the adult nervous system, these findings suggest the possibility that BMP-5 regulates dendritic morphology not only in the developing, but also the adult nervous system. BMP-5 may play important roles not only in myocardial differentiation, but also in the formation and maintenance of endocardial cushion tissue. Additionally, high expression level of BMP-5 has been detected in certain tumors of mesenchymal origin.

Full Name
bone morphogenetic protein 5
References
  • Yamagishi T, et al. (2001) Expression of bone morphogenetic protein-5 gene during chick heart development: possible roles in valvuloseptal endocardial cushion formation. Anat Rec. 264(4): 313-6.
  • Beck HN, et al. (2001) Bone morphogenetic protein-5 (BMP-5) promotes dendritic growth in cultured sympathetic neurons. BMC Neurosci. 2:12.
  • Zuzarte-Lus V, et al. (2004) A new role for BMP5 during limb development acting through the synergic activation of Smad and MAPK pathways. Dev Biol. 272(1): 39-52.
  • BMP5 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    BMP5 cDNA ORF Clone in Cloning Vector, Canine DG70075-G
    BMP5 cDNA ORF Clone, Canine, untagged DG70075-UT
    BMP5 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70075-ACG
    BMP5 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70075-ACGLN
    BMP5 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70075-ACR
    BMP5 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70075-CF
    BMP5 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70075-NF
    BMP5 cDNA ORF Clone, Canine, C-His tag DG70075-CH
    BMP5 cDNA ORF Clone, Canine, N-His tag DG70075-NH
    BMP5 cDNA ORF Clone, Canine, C-HA tag DG70075-CY
    BMP5 cDNA ORF Clone, Canine, N-HA tag DG70075-NY
    BMP5 cDNA ORF Clone, Canine, C-Myc tag DG70075-CM
    BMP5 cDNA ORF Clone, Canine, N-Myc tag DG70075-NM

    BMP5 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    BMP5 cDNA ORF Clone in Cloning Vector, Rhesus CG90053-G
    BMP5 cDNA ORF Clone, Rhesus, untagged CG90053-UT
    BMP5 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90053-ACG
    BMP5 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90053-ACGLN
    BMP5 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90053-ACR
    BMP5 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90053-CF
    BMP5 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90053-NF
    BMP5 cDNA ORF Clone, Rhesus, C-His tag CG90053-CH
    BMP5 cDNA ORF Clone, Rhesus, C-HA tag CG90053-CY
    BMP5 cDNA ORF Clone, Rhesus, N-HA tag CG90053-NY
    BMP5 cDNA ORF Clone, Rhesus, C-Myc tag CG90053-CM
    BMP5 cDNA ORF Clone, Rhesus, N-Myc tag CG90053-NM

    BMP5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    BMP5 cDNA ORF Clone in Cloning Vector, Mouse MG50703-M
    BMP5 cDNA ORF Clone, Mouse, untagged MG50703-UT
    BMP5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50703-ACGLN
    BMP5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50703-ACG
    BMP5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50703-ACR
    BMP5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50703-CF
    BMP5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50703-NF
    BMP5 cDNA ORF Clone, Mouse, C-His tag MG50703-CH
    BMP5 cDNA ORF Clone, Mouse, N-His tag MG50703-NH
    BMP5 cDNA ORF Clone, Mouse, C-HA tag MG50703-CY
    BMP5 cDNA ORF Clone, Mouse, N-HA tag MG50703-NY
    BMP5 cDNA ORF Clone, Mouse, C-Myc tag MG50703-CM
    BMP5 cDNA ORF Clone, Mouse, N-Myc tag MG50703-NM
    BMP5 qPCR Primer Pairs, Mouse MP200678

    BMP5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    BMP5 cDNA ORF Clone in Cloning Vector, Human HG10214-M
    BMP5 cDNA ORF Clone, Human, untagged HG10214-UT
    BMP5 cDNA ORF Clone, Human, C-GFPSpark® tag HG10214-ACG
    BMP5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10214-ACGLN
    BMP5 cDNA ORF Clone, Human, C-OFPSpark® tag HG10214-ACR
    BMP5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10214-CF
    BMP5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10214-NF
    BMP5 cDNA ORF Clone, Human, C-His tag HG10214-CH
    BMP5 cDNA ORF Clone, Human, N-His tag HG10214-NH
    BMP5 cDNA ORF Clone, Human, C-HA tag HG10214-CY
    BMP5 cDNA ORF Clone, Human, N-HA tag HG10214-NY
    BMP5 cDNA ORF Clone, Human, C-Myc tag HG10214-CM
    BMP5 cDNA ORF Clone, Human, N-Myc tag HG10214-NM
    BMP5 qPCR Primer Pairs, Human HP100272
    info info
    添加购物车成功! 添加购物车失败!