Quick Order

Rhesus BMP-2 Gene ORF cDNA clone expression plasmid, C-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Rhesus BMP2 cDNA Clone Product Information
    NCBI RefSeq:XM_001115987.1
    RefSeq ORF Size:1191bp
    cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) bone morphogenetic protein 2 with C terminal Myc tag.
    Gene Synonym:BMP2
    Species:Rhesus
    Vector:pCMV3-C-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    BMP-2 protein, like other bone morphogenetic proteins, plays an important role in the development of bone and cartilage. BMP-2 protein is involved in the hedgehog pathway, TGF beta signaling pathway, and cytokine-cytokine receptor interaction. BMP-2 and BMP-7 are osteogenic BMPs that have been demonstrated to potently induce osteoblast differentiation in a variety of cell types. BMP-2, BMP-4 and BMP-7 are known to be of major importance in bone formation and repair. In cancerous tissues BMP-2 protein may play an important role in the progression of glioma.

    References
  • Jiao X, et al. (2007) Heparan sulfate proteoglycans (HSPGs) modulate BMP-2 osteogenic bioactivity in C2C12 cells. J Biol Chem. 282(2):1080-6.
  • Michon F, et al. (2008) BMP-2 and BMP-7 play antagonistic roles in feather induction. Development 135 (16):2797-805.
  • Size / Price
    Catalog: CG90041-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"