BMP10 cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90070-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BMP10 Reagents
CRO Services
Product recommended

All BMP10 Reagents
BMP10 cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1275 bp
Description
Full length Clone DNA of Rhesus bone morphogenetic protein 10 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BMP10 Background Information
Full Name
bone morphogenetic protein 10

BMP10 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
BMP10 cDNA ORF Clone in Cloning Vector, Rhesus CG90070-G
BMP10 cDNA ORF Clone, Rhesus, untagged CG90070-UT
BMP10 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90070-ACG
BMP10 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90070-ACGLN
BMP10 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90070-ACR
BMP10 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90070-CF
BMP10 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90070-NF
BMP10 cDNA ORF Clone, Rhesus, C-His tag CG90070-CH
BMP10 cDNA ORF Clone, Rhesus, N-His tag CG90070-NH
BMP10 cDNA ORF Clone, Rhesus, C-HA tag CG90070-CY
BMP10 cDNA ORF Clone, Rhesus, N-HA tag CG90070-NY
BMP10 cDNA ORF Clone, Rhesus, C-Myc tag CG90070-CM

BMP10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BMP10 cDNA ORF Clone in Cloning Vector, Rat RG80121-G
BMP10 cDNA ORF Clone, Rat, untagged RG80121-UT
BMP10 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80121-ACG
BMP10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80121-ACGLN
BMP10 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80121-ACR
BMP10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80121-CF
BMP10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80121-NF
BMP10 cDNA ORF Clone, Rat, C-His tag RG80121-CH
BMP10 cDNA ORF Clone, Rat, N-His tag RG80121-NH
BMP10 cDNA ORF Clone, Rat, C-HA tag RG80121-CY
BMP10 cDNA ORF Clone, Rat, N-HA tag RG80121-NY
BMP10 cDNA ORF Clone, Rat, C-Myc tag RG80121-CM
BMP10 cDNA ORF Clone, Rat, N-Myc tag RG80121-NM
BMP10 qPCR Primer Pairs, Rat RP300116

BMP10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BMP10 cDNA ORF Clone in Cloning Vector, Human HG10819-M
BMP10 cDNA ORF Clone, Human, untagged HG10819-UT
BMP10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10819-ACGLN
BMP10 cDNA ORF Clone, Human, C-GFPSpark® tag HG10819-ACG
BMP10 cDNA ORF Clone, Human, C-OFPSpark® tag HG10819-ACR
BMP10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10819-CF
BMP10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10819-NF
BMP10 cDNA ORF Clone, Human, C-His tag HG10819-CH
BMP10 cDNA ORF Clone, Human, N-His tag HG10819-NH
BMP10 cDNA ORF Clone, Human, C-HA tag HG10819-CY
BMP10 cDNA ORF Clone, Human, N-HA tag HG10819-NY
BMP10 cDNA ORF Clone, Human, C-Myc tag HG10819-CM
BMP10 cDNA ORF Clone, Human, N-Myc tag HG10819-NM
BMP10 qPCR Primer Pairs, Human HP100916
info info
添加购物车成功! 添加购物车失败!