BAP31/BCAP31 cDNA ORF Clone, Cynomolgus, N-Myc tag

Cat: CG90711-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All BAP31/BCAP31 Reagents
CRO Services
Product recommended

All BAP31/BCAP31 Reagents
BAP31/BCAP31 cDNA ORF Clone, Cynomolgus, N-Myc tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
741 bp
Description
Full length Clone DNA of Cynomolgus B-cell receptor-associated protein 31 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BAP31/BCAP31 Background Information
Full Name
B-cell receptor-associated protein 31

BAP31/BCAP31 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
BAP31/BCAP31 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90711-G
BAP31/BCAP31 cDNA ORF Clone, Cynomolgus, untagged CG90711-UT
BAP31/BCAP31 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90711-ACGLN
BAP31/BCAP31 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90711-ACG
BAP31/BCAP31 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90711-ACR
BAP31/BCAP31 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90711-CF
BAP31/BCAP31 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90711-NF
BAP31/BCAP31 cDNA ORF Clone, Cynomolgus, C-His tag CG90711-CH
BAP31/BCAP31 cDNA ORF Clone, Cynomolgus, N-His tag CG90711-NH
BAP31/BCAP31 cDNA ORF Clone, Cynomolgus, C-HA tag CG90711-CY
BAP31/BCAP31 cDNA ORF Clone, Cynomolgus, N-HA tag CG90711-NY
BAP31/BCAP31 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90711-CM

BAP31/BCAP31 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
BAP31/BCAP31 cDNA ORF Clone in Cloning Vector, Rat RG80996-U
BAP31/BCAP31 cDNA ORF Clone, Rat, untagged RG80996-UT
BAP31/BCAP31 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80996-ACG
BAP31/BCAP31 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80996-ACGLN
BAP31/BCAP31 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80996-ACR
BAP31/BCAP31 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80996-CF
BAP31/BCAP31 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80996-NF
BAP31/BCAP31 cDNA ORF Clone, Rat, C-His tag RG80996-CH
BAP31/BCAP31 cDNA ORF Clone, Rat, N-His tag RG80996-NH
BAP31/BCAP31 cDNA ORF Clone, Rat, C-HA tag RG80996-CY
BAP31/BCAP31 cDNA ORF Clone, Rat, N-HA tag RG80996-NY
BAP31/BCAP31 cDNA ORF Clone, Rat, C-Myc tag RG80996-CM
BAP31/BCAP31 cDNA ORF Clone, Rat, N-Myc tag RG80996-NM
BAP31/BCAP31 qPCR Primer Pairs, Rat RP300960

BAP31/BCAP31 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
BAP31/BCAP31 cDNA ORF Clone in Cloning Vector, Mouse MG51794-G
BAP31/BCAP31 cDNA ORF Clone, Mouse, untagged MG51794-UT
BAP31/BCAP31 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51794-ACGLN
BAP31/BCAP31 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51794-ACG
BAP31/BCAP31 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51794-ACR
BAP31/BCAP31 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51794-CF
BAP31/BCAP31 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51794-NF
BAP31/BCAP31 cDNA ORF Clone, Mouse, C-His tag MG51794-CH
BAP31/BCAP31 cDNA ORF Clone, Mouse, N-His tag MG51794-NH
BAP31/BCAP31 cDNA ORF Clone, Mouse, C-HA tag MG51794-CY
BAP31/BCAP31 cDNA ORF Clone, Mouse, N-HA tag MG51794-NY
BAP31/BCAP31 cDNA ORF Clone, Mouse, C-Myc tag MG51794-CM
BAP31/BCAP31 cDNA ORF Clone, Mouse, N-Myc tag MG51794-NM
BAP31/BCAP31 qPCR Primer Pairs, Mouse MP201667

BAP31/BCAP31 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
BAP31/BCAP31 cDNA ORF Clone in Cloning Vector, Human HG11332-M
BAP31/BCAP31 cDNA ORF Clone, Human, untagged HG11332-UT
BAP31/BCAP31 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11332-ACGLN
BAP31/BCAP31 cDNA ORF Clone, Human, C-GFPSpark® tag HG11332-ACG
BAP31/BCAP31 cDNA ORF Clone, Human, C-OFPSpark® tag HG11332-ACR
BAP31/BCAP31 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11332-CF
BAP31/BCAP31 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11332-NF
BAP31/BCAP31 cDNA ORF Clone, Human, C-His tag HG11332-CH
BAP31/BCAP31 cDNA ORF Clone, Human, N-His tag HG11332-NH
BAP31/BCAP31 cDNA ORF Clone, Human, C-HA tag HG11332-CY
BAP31/BCAP31 cDNA ORF Clone, Human, N-HA tag HG11332-NY
BAP31/BCAP31 cDNA ORF Clone, Human, C-Myc tag HG11332-CM
BAP31/BCAP31 cDNA ORF Clone, Human, N-Myc tag HG11332-NM
BAP31/BCAP31 qPCR Primer Pairs, Human HP101217
info info
添加购物车成功! 添加购物车失败!