ATP6V1C1 cDNA ORF Clone, Cynomolgus, untagged

Cat: CG90781-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ATP6V1C1 Reagents
CRO Services
Product recommended

All ATP6V1C1 Reagents
ATP6V1C1 cDNA ORF Clone, Cynomolgus, untagged General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1149 bp
Description
Full length Clone DNA of Cynomolgus uncharacterized LOC101866706.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP6V1C1 Background Information
Full Name
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1

ATP6V1C1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
ATP6V1C1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90781-G
ATP6V1C1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90781-ACGLN
ATP6V1C1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90781-ACG
ATP6V1C1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90781-ANG
ATP6V1C1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90781-ACR
ATP6V1C1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90781-ANR
ATP6V1C1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90781-CF
ATP6V1C1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90781-NF
ATP6V1C1 cDNA ORF Clone, Cynomolgus, C-His tag CG90781-CH
ATP6V1C1 cDNA ORF Clone, Cynomolgus, N-His tag CG90781-NH
ATP6V1C1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90781-CY
ATP6V1C1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90781-NY
ATP6V1C1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90781-CM
ATP6V1C1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90781-NM

ATP6V1C1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATP6V1C1 cDNA ORF Clone in Cloning Vector, Rat RG80878-U
ATP6V1C1 cDNA ORF Clone, Rat, untagged RG80878-UT
ATP6V1C1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80878-ACGLN
ATP6V1C1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80878-ACG
ATP6V1C1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80878-ANG
ATP6V1C1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80878-ACR
ATP6V1C1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80878-ANR
ATP6V1C1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80878-CF
ATP6V1C1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80878-NF
ATP6V1C1 cDNA ORF Clone, Rat, C-His tag RG80878-CH
ATP6V1C1 cDNA ORF Clone, Rat, N-His tag RG80878-NH
ATP6V1C1 cDNA ORF Clone, Rat, C-HA tag RG80878-CY
ATP6V1C1 cDNA ORF Clone, Rat, N-HA tag RG80878-NY
ATP6V1C1 cDNA ORF Clone, Rat, C-Myc tag RG80878-CM
ATP6V1C1 cDNA ORF Clone, Rat, N-Myc tag RG80878-NM
ATP6V1C1 qPCR Primer Pairs, Rat RP300842

ATP6V1C1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP6V1C1 cDNA ORF Clone in Cloning Vector, Human HG16958-U
ATP6V1C1 cDNA ORF Clone, Human, untagged HG16958-UT
ATP6V1C1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16958-ACGLN
ATP6V1C1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16958-ACG
ATP6V1C1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16958-ACR
ATP6V1C1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16958-CF
ATP6V1C1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16958-NF
ATP6V1C1 cDNA ORF Clone, Human, C-His tag HG16958-CH
ATP6V1C1 cDNA ORF Clone, Human, N-His tag HG16958-NH
ATP6V1C1 cDNA ORF Clone, Human, C-HA tag HG16958-CY
ATP6V1C1 cDNA ORF Clone, Human, N-HA tag HG16958-NY
ATP6V1C1 cDNA ORF Clone, Human, C-Myc tag HG16958-CM
ATP6V1C1 cDNA ORF Clone, Human, N-Myc tag HG16958-NM
info info
添加购物车成功! 添加购物车失败!