ATP5A1 cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90790-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ATP5A1 Reagents
CRO Services
Product recommended

All ATP5A1 Reagents
ATP5A1 cDNA ORF Clone, Rhesus, N-Myc tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1662 bp
Description
Full length Clone DNA of Rhesus ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ATP5A1 Background Information
Full Name
ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle

ATP5A1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
ATP5A1 cDNA ORF Clone in Cloning Vector, Rhesus CG90790-G
ATP5A1 cDNA ORF Clone, Rhesus, untagged CG90790-UT
ATP5A1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90790-ACG
ATP5A1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90790-ACGLN
ATP5A1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90790-ANG
ATP5A1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90790-ACR
ATP5A1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90790-ANR
ATP5A1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90790-CF
ATP5A1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90790-NF
ATP5A1 cDNA ORF Clone, Rhesus, C-His tag CG90790-CH
ATP5A1 cDNA ORF Clone, Rhesus, N-His tag CG90790-NH
ATP5A1 cDNA ORF Clone, Rhesus, C-HA tag CG90790-CY
ATP5A1 cDNA ORF Clone, Rhesus, N-HA tag CG90790-NY
ATP5A1 cDNA ORF Clone, Rhesus, C-Myc tag CG90790-CM

ATP5A1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ATP5A1 cDNA ORF Clone in Cloning Vector, Rat RG80909-U
ATP5A1 cDNA ORF Clone, Rat, untagged RG80909-UT
ATP5A1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80909-ACGLN
ATP5A1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80909-ACG
ATP5A1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80909-ANG
ATP5A1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80909-ACR
ATP5A1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80909-ANR
ATP5A1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80909-CF
ATP5A1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80909-NF
ATP5A1 cDNA ORF Clone, Rat, C-His tag RG80909-CH
ATP5A1 cDNA ORF Clone, Rat, N-His tag RG80909-NH
ATP5A1 cDNA ORF Clone, Rat, C-HA tag RG80909-CY
ATP5A1 cDNA ORF Clone, Rat, N-HA tag RG80909-NY
ATP5A1 cDNA ORF Clone, Rat, C-Myc tag RG80909-CM
ATP5A1 cDNA ORF Clone, Rat, N-Myc tag RG80909-NM
ATP5A1 qPCR Primer Pairs, Rat RP300873

ATP5A1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ATP5A1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59917-CF

ATP5A1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ATP5A1 cDNA ORF Clone in Cloning Vector, Human HG14419-G
ATP5A1 cDNA ORF Clone, Human, untagged HG14419-UT
ATP5A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14419-ACG
ATP5A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14419-ACGLN
ATP5A1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14419-ANG
ATP5A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14419-ACR
ATP5A1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14419-ANR
ATP5A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14419-CF
ATP5A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14419-NF
ATP5A1 cDNA ORF Clone, Human, C-His tag HG14419-CH
ATP5A1 cDNA ORF Clone, Human, N-His tag HG14419-NH
ATP5A1 cDNA ORF Clone, Human, C-HA tag HG14419-CY
ATP5A1 cDNA ORF Clone, Human, N-HA tag HG14419-NY
ATP5A1 cDNA ORF Clone, Human, C-Myc tag HG14419-CM
ATP5A1 cDNA ORF Clone, Human, N-Myc tag HG14419-NM
ATP5A1 qPCR Primer Pairs, Human HP103068
info info
添加购物车成功! 添加购物车失败!