beta Amylase cDNA ORF Clone, Rhesus, N-HA tag

Cat: CG90526-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All beta Amylase Reagents
CRO Services
Product recommended

All beta Amylase Reagents
beta Amylase cDNA ORF Clone, Rhesus, N-HA tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1536 bp
Description
Full length Clone DNA of Rhesus amylase, alpha 2B (pancreatic) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

beta Amylase Background Information

Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, and thus catalyze the first step in digestion of dietary starch and glycogen. Alpha-amylase is the major form of amylase found in humans and other mammals. Alpha-amylase hydrolyses alpha bonds of large, alpha-linked polysaccharides, such as starch and glycogen, yielding glucose and maltose. Amylases is widely expressed and is most prominent in pancreatic juice and saliva, each of which has its own isoform of human α-amylase. They behave differently on isoelectric focusing, and can also be separated in testing by using specific monoclonal antibodies.

Full Name
amylase, alpha 2B (pancreatic)
References
  • Abe A. et al., 2005, FEBS J. 272 (23): 6145-53.
  • Aghajari N. et al., 1998, Protein Sci. 7 (3): 564-72.
  • Ramasubbu N. et al., 1996, Acta Crystallographica Section D Biological Crystallography. 52 (3): 435-46.
  • beta Amylase cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    beta Amylase cDNA ORF Clone in Cloning Vector, Rhesus CG90526-U
    beta Amylase cDNA ORF Clone in Cloning Vector, Rhesus CG90012-G
    beta Amylase cDNA ORF Clone, Rhesus, untagged CG90526-UT
    beta Amylase cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90526-ACG
    beta Amylase Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90526-ACGLN
    beta Amylase cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90526-ACR
    beta Amylase cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90526-CF
    beta Amylase cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90526-NF
    beta Amylase cDNA ORF Clone, Rhesus, C-His tag CG90526-CH
    beta Amylase cDNA ORF Clone, Rhesus, N-His tag CG90526-NH
    beta Amylase cDNA ORF Clone, Rhesus, C-HA tag CG90526-CY
    beta Amylase cDNA ORF Clone, Rhesus, C-Myc tag CG90526-CM
    beta Amylase cDNA ORF Clone, Rhesus, N-Myc tag CG90526-NM

    beta Amylase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    beta Amylase cDNA ORF Clone in Cloning Vector, Human HG13575-G
    beta Amylase cDNA ORF Clone, Human, untagged HG13575-UT
    beta Amylase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13575-ACGLN
    beta Amylase cDNA ORF Clone, Human, C-GFPSpark® tag HG13575-ACG
    beta Amylase cDNA ORF Clone, Human, C-OFPSpark® tag HG13575-ACR
    beta Amylase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13575-CF
    beta Amylase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13575-NF
    beta Amylase cDNA ORF Clone, Human, C-His tag HG13575-CH
    beta Amylase cDNA ORF Clone, Human, N-His tag HG13575-NH
    beta Amylase cDNA ORF Clone, Human, C-HA tag HG13575-CY
    beta Amylase cDNA ORF Clone, Human, N-HA tag HG13575-NY
    beta Amylase cDNA ORF Clone, Human, C-Myc tag HG13575-CM
    beta Amylase cDNA ORF Clone, Human, N-Myc tag HG13575-NM
    beta Amylase qPCR Primer Pairs, Human HP102261
    info info
    添加购物车成功! 添加购物车失败!