Adenosine Deaminase cDNA ORF Clone, Cynomolgus, C-HA tag

Cat: CG90480-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Adenosine Deaminase Reagents
CRO Services
Product recommended

All Adenosine Deaminase Reagents
Adenosine Deaminase cDNA ORF Clone, Cynomolgus, C-HA tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1092 bp
Description
Full length Clone DNA of Cynomolgus adenosine deaminase with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Adenosine Deaminase Background Information
Full Name
adenosine deaminase

Adenosine Deaminase cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
Adenosine Deaminase cDNA ORF Clone in Cloning Vector, Cynomolgus CG90480-G
Adenosine Deaminase cDNA ORF Clone, Cynomolgus, untagged CG90480-UT
Adenosine Deaminase Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90480-ACGLN
Adenosine Deaminase cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90480-ACG
Adenosine Deaminase cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90480-ANG
Adenosine Deaminase cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90480-ACR
Adenosine Deaminase cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90480-ANR
Adenosine Deaminase cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90480-CF
Adenosine Deaminase cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90480-NF
Adenosine Deaminase cDNA ORF Clone, Cynomolgus, C-His tag CG90480-CH
Adenosine Deaminase cDNA ORF Clone, Cynomolgus, N-His tag CG90480-NH
Adenosine Deaminase cDNA ORF Clone, Cynomolgus, N-HA tag CG90480-NY
Adenosine Deaminase cDNA ORF Clone, Cynomolgus, C-Myc tag CG90480-CM
Adenosine Deaminase cDNA ORF Clone, Cynomolgus, N-Myc tag CG90480-NM

Adenosine Deaminase cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Adenosine Deaminase cDNA ORF Clone in Cloning Vector, Rat RG80863-U
Adenosine Deaminase cDNA ORF Clone, Rat, untagged RG80863-UT
Adenosine Deaminase cDNA ORF Clone, Rat, C-GFPSpark® tag RG80863-ACG
Adenosine Deaminase Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80863-ACGLN
Adenosine Deaminase cDNA ORF Clone, Rat, C-OFPSpark® tag RG80863-ACR
Adenosine Deaminase cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80863-CF
Adenosine Deaminase cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80863-NF
Adenosine Deaminase cDNA ORF Clone, Rat, C-His tag RG80863-CH
Adenosine Deaminase cDNA ORF Clone, Rat, N-His tag RG80863-NH
Adenosine Deaminase cDNA ORF Clone, Rat, C-HA tag RG80863-CY
Adenosine Deaminase cDNA ORF Clone, Rat, N-HA tag RG80863-NY
Adenosine Deaminase cDNA ORF Clone, Rat, C-Myc tag RG80863-CM
Adenosine Deaminase cDNA ORF Clone, Rat, N-Myc tag RG80863-NM
Adenosine Deaminase qPCR Primer Pairs, Rat RP300827

Adenosine Deaminase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Adenosine Deaminase cDNA ORF Clone, Mouse, untagged MG57301-UT
Adenosine Deaminase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57301-ACGLN
Adenosine Deaminase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57301-ACG
Adenosine Deaminase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57301-ACR
Adenosine Deaminase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57301-CF
Adenosine Deaminase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57301-NF
Adenosine Deaminase cDNA ORF Clone, Mouse, C-His tag MG57301-CH
Adenosine Deaminase cDNA ORF Clone, Mouse, N-His tag MG57301-NH
Adenosine Deaminase cDNA ORF Clone, Mouse, C-HA tag MG57301-CY
Adenosine Deaminase cDNA ORF Clone, Mouse, N-HA tag MG57301-NY
Adenosine Deaminase cDNA ORF Clone, Mouse, C-Myc tag MG57301-CM
Adenosine Deaminase cDNA ORF Clone, Mouse, N-Myc tag MG57301-NM

Adenosine Deaminase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Adenosine Deaminase cDNA ORF Clone in Cloning Vector, Human HG14737-G
Adenosine Deaminase cDNA ORF Clone, Human, untagged HG14737-UT
Adenosine Deaminase cDNA ORF Clone, Human, C-GFPSpark® tag HG14737-ACG
Adenosine Deaminase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14737-ACGLN
Adenosine Deaminase cDNA ORF Clone, Human, C-OFPSpark® tag HG14737-ACR
Adenosine Deaminase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14737-CF
Adenosine Deaminase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14737-NF
Adenosine Deaminase cDNA ORF Clone, Human, C-His tag HG14737-CH
Adenosine Deaminase cDNA ORF Clone, Human, N-His tag HG14737-NH
Adenosine Deaminase cDNA ORF Clone, Human, C-HA tag HG14737-CY
Adenosine Deaminase cDNA ORF Clone, Human, N-HA tag HG14737-NY
Adenosine Deaminase cDNA ORF Clone, Human, C-Myc tag HG14737-CM
Adenosine Deaminase cDNA ORF Clone, Human, N-Myc tag HG14737-NM
Adenosine Deaminase qPCR Primer Pairs, Human HP103370
info info
添加购物车成功! 添加购物车失败!