Quick Order

Rhesus ALK-1/ACVRL1 Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Cynomolgus ACVRL1 cDNA Clone Product Information
    NCBI RefSeq:XM_001091113.2
    RefSeq ORF Size:1512bp
    cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) activin A receptor type II-like 1 with N terminal His tag.
    Gene Synonym:ACVRL1
    Species:Rhesus
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    Activin A receptor, type II-like 1 (ACVRL1), also known as ALK-1 (activin receptor-like kinase 1), is an endothelial-specific type I receptor of the TGF-beta (transforming growth factor beta) receptor family of ligands. On ligand binding, a heteromeric receptor complex forms consisting of two type II and two type I transmembrane serine/threonine kinases. ACVRL1 protein is expressed in certain blood vessels of kidney, spleen, heart and intestine, serving as an important role during vascular development. Mutations in ACVRL1 gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2 and vascular disease.

    References
  • French Rendu-Osler network,et al. (2004) Molecular screening of ALK1/ACVRL1 and ENG genes in hereditary hemorrhagic telangiectasia in France. Hum Mutat. 23(4): 289-299.
  • Simon M, et al. (2006) Association of a polymorphism of the ACVRL1 gene with sporadic arteriovenous malformations of the central nervous system. J Neurosurg. 104(6): 945-9.
  • Argyriou L, et al. (2006) Novel mutations in the ENG and ACVRL1 genes causing hereditary hemorrhagic teleangiectasia. Int J Mol Med. 17(4):655-9.
  • Size / Price
    Catalog: CG90060-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"