Quick Order

Text Size:AAA

Rhesus ALK-7 / ACVR1C Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Cynomolgus ACVR1C cDNA Clone Product Information
NCBI RefSeq:XM_001088578.2
RefSeq ORF Size:1482bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) activin A receptor, type IC with N terminal Myc tag.
Gene Synonym:ACVR1C
Species:Rhesus
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

ALK-7, also known as ALK7 and ACVR1C, belongs to the ALK family. It is a type I receptor for the TGFB family of signaling molecules. TGF-β is the prototype of a protein superfamily which, in humans, contains at least 35 members, including activins, inhibins, bone morphogenetic proteins, growth/differentiation factors, and Müllerian inhibiting substance. ALK-7 is a serine-threonine kinase that can cause the activation of one of the SMAD signal transducers, SMAD2. ALK-7 has a ligand known as Nodal. Nodal stimulates the secretion of TIMP-1 and inhibits matrix metalloproteinases MMP-2 and MMP-9 activity. The overexpression of Nodal or constitutively active ALK-7 decreases cell migration and invasion, whereas knock-down of Nodal and ALK-7 has the opposite effects.

References
  • Lin YY, et al. (2012) Functional dissection of lysine deacetylases reveals that HDAC1 and p300 regulate AMPK. Nature. 482(7384):251-5.
  • He C, et al. (2010) A large-scale candidate gene association study of age at menarche and age at natural menopause. Hum Genet. 128(5):515-27.
  • Watanabe R, et al. (2008) Insulin gene is a target in activin receptor-like kinase 7 signaling pathway in pancreatic beta-cells. Biochem Biophys Res Commun. 377(3):867-72.
  • Size / Price
    Catalog: CG90067-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"