Quick Order

Rhesus ALK-7 / ACVR1C Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Cynomolgus ACVR1C cDNA Clone Product Information
    NCBI RefSeq:XM_001088578.2
    RefSeq ORF Size:1482bp
    cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) activin A receptor, type IC with N terminal His tag.
    Gene Synonym:ACVR1C
    Species:Rhesus
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    ALK-7, also known as ALK7 and ACVR1C, belongs to the ALK family. It is a type I receptor for the TGFB family of signaling molecules. TGF-β is the prototype of a protein superfamily which, in humans, contains at least 35 members, including activins, inhibins, bone morphogenetic proteins, growth/differentiation factors, and Müllerian inhibiting substance. ALK-7 is a serine-threonine kinase that can cause the activation of one of the SMAD signal transducers, SMAD2. ALK-7 has a ligand known as Nodal. Nodal stimulates the secretion of TIMP-1 and inhibits matrix metalloproteinases MMP-2 and MMP-9 activity. The overexpression of Nodal or constitutively active ALK-7 decreases cell migration and invasion, whereas knock-down of Nodal and ALK-7 has the opposite effects.

    References
  • Lin YY, et al. (2012) Functional dissection of lysine deacetylases reveals that HDAC1 and p300 regulate AMPK. Nature. 482(7384):251-5.
  • He C, et al. (2010) A large-scale candidate gene association study of age at menarche and age at natural menopause. Hum Genet. 128(5):515-27.
  • Watanabe R, et al. (2008) Insulin gene is a target in activin receptor-like kinase 7 signaling pathway in pancreatic beta-cells. Biochem Biophys Res Commun. 377(3):867-72.
  • Size / Price
    Catalog: CG90067-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"