ACVR1B cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90066-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ACVR1B Reagents
CRO Services
Product recommended

All ACVR1B Reagents
ACVR1B cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1518 bp
Description
Full length Clone DNA of Rhesus activin A receptor, type IB with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ACVR1B Background Information

ALK-4 (Activin Receptor-Like Kinase 4) or ACVR1B (Activin A Receptor, type 1B), belongs to the protein kinase superfamily, TKL Ser/Thr protein kinase family, and TGFB receptor subfamily. ALK-4/ACVR1B acts as a transducer of activin or activin like ligands signals. Activin binds to either ACVR2A or ACVR2B and then forms a complex with ACVR1B. The known type II activin receptors include ActRII and ActRIIB, while the main type I activin receptor in mammalian cells is ALK-4 (ActRIB). In the presence of activin, type II and type I receptors form complexes whereby the type II receptors activate ALK-4 through phosphorylation. The activated ALK-4, in turn, transduces signals downstream by phosphorylation of its effectors, such as Smads, to regulate gene expression and affect cellular phenotype. ALK-4/ACVR1B is an important regulator of vertebrate development, with roles in mesoderm induction, primitive streak formation, gastrulation, dorsoanterior patterning, and left-right axis determination.

Full Name
activin A receptor, type IB
References
  • Chen Y, et al. (2005) Developmental analysis of activin-like kinase receptor-4 (ALK4) expression in Xenopus laevis. 232(2): 393-8.
  • J. Massagu. (1998) TGF- SIGNAL TRANSDUCTION. Annual Review of Biochemistry. 67: 753-91.
  • ACVR1B cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    ACVR1B cDNA ORF Clone in Cloning Vector, Rhesus CG90066-G
    ACVR1B cDNA ORF Clone, Rhesus, untagged CG90066-UT
    ACVR1B cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90066-ACG
    ACVR1B Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90066-ACGLN
    ACVR1B cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90066-ACR
    ACVR1B cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90066-CF
    ACVR1B cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90066-NF
    ACVR1B cDNA ORF Clone, Rhesus, C-His tag CG90066-CH
    ACVR1B cDNA ORF Clone, Rhesus, C-HA tag CG90066-CY
    ACVR1B cDNA ORF Clone, Rhesus, N-HA tag CG90066-NY
    ACVR1B cDNA ORF Clone, Rhesus, C-Myc tag CG90066-CM
    ACVR1B cDNA ORF Clone, Rhesus, N-Myc tag CG90066-NM

    ACVR1B cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    ACVR1B cDNA ORF Clone in Cloning Vector, Canine DG70061-G
    ACVR1B cDNA ORF Clone, Canine, untagged DG70061-UT
    ACVR1B cDNA ORF Clone, Canine, C-GFPSpark® tag DG70061-ACG
    ACVR1B Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70061-ACGLN
    ACVR1B cDNA ORF Clone, Canine, C-OFPSpark® tag DG70061-ACR
    ACVR1B cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70061-CF
    ACVR1B cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70061-NF
    ACVR1B cDNA ORF Clone, Canine, C-His tag DG70061-CH
    ACVR1B cDNA ORF Clone, Canine, N-His tag DG70061-NH
    ACVR1B cDNA ORF Clone, Canine, C-HA tag DG70061-CY
    ACVR1B cDNA ORF Clone, Canine, N-HA tag DG70061-NY
    ACVR1B cDNA ORF Clone, Canine, C-Myc tag DG70061-CM
    ACVR1B cDNA ORF Clone, Canine, N-Myc tag DG70061-NM

    ACVR1B cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ACVR1B cDNA ORF Clone in Cloning Vector, Rat RG80137-G
    ACVR1B cDNA ORF Clone, Rat, untagged RG80137-UT
    ACVR1B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80137-ACGLN
    ACVR1B cDNA ORF Clone, Rat, C-GFPSpark® tag RG80137-ACG
    ACVR1B cDNA ORF Clone, Rat, C-OFPSpark® tag RG80137-ACR
    ACVR1B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80137-CF
    ACVR1B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80137-NF
    ACVR1B cDNA ORF Clone, Rat, C-His tag RG80137-CH
    ACVR1B cDNA ORF Clone, Rat, N-His tag RG80137-NH
    ACVR1B cDNA ORF Clone, Rat, C-HA tag RG80137-CY
    ACVR1B cDNA ORF Clone, Rat, N-HA tag RG80137-NY
    ACVR1B cDNA ORF Clone, Rat, C-Myc tag RG80137-CM
    ACVR1B cDNA ORF Clone, Rat, N-Myc tag RG80137-NM
    ACVR1B qPCR Primer Pairs, Rat RP300133

    ACVR1B cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ACVR1B cDNA ORF Clone in Cloning Vector, Human HG10583-M
    ACVR1B cDNA ORF Clone, Human, untagged HG10583-UT
    ACVR1B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10583-ACGLN
    ACVR1B cDNA ORF Clone, Human, C-GFPSpark® tag HG10583-ACG
    ACVR1B cDNA ORF Clone, Human, C-OFPSpark® tag HG10583-ACR
    ACVR1B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10583-CF
    ACVR1B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10583-NF
    ACVR1B cDNA ORF Clone, Human, C-His tag HG10583-CH
    ACVR1B cDNA ORF Clone, Human, N-His tag HG10583-NH
    ACVR1B cDNA ORF Clone, Human, C-HA tag HG10583-CY
    ACVR1B cDNA ORF Clone, Human, N-HA tag HG10583-NY
    ACVR1B cDNA ORF Clone, Human, C-Myc tag HG10583-CM
    ACVR1B cDNA ORF Clone, Human, N-Myc tag HG10583-NM
    ACVR1B qPCR Primer Pairs, Human HP100587
    info info
    添加购物车成功! 添加购物车失败!