ABHD13 cDNA ORF Clone, Cynomolgus, C-Myc tag

Cat: CG90546-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ABHD13 Reagents
CRO Services
Product recommended

All ABHD13 Reagents
ABHD13 cDNA ORF Clone, Cynomolgus, C-Myc tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1014 bp
Description
Full length Clone DNA of Cynomolgus abhydrolase domain containing 13 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ABHD13 Background Information
Full Name
abhydrolase domain containing 13

ABHD13 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
ABHD13 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90546-U
ABHD13 cDNA ORF Clone, Cynomolgus, untagged CG90546-UT
ABHD13 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90546-ACG
ABHD13 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90546-ACGLN
ABHD13 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90546-ANG
ABHD13 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90546-ACR
ABHD13 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90546-ANR
ABHD13 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90546-CF
ABHD13 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90546-NF
ABHD13 cDNA ORF Clone, Cynomolgus, C-His tag CG90546-CH
ABHD13 cDNA ORF Clone, Cynomolgus, N-His tag CG90546-NH
ABHD13 cDNA ORF Clone, Cynomolgus, C-HA tag CG90546-CY
ABHD13 cDNA ORF Clone, Cynomolgus, N-HA tag CG90546-NY
ABHD13 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90546-NM

ABHD13 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ABHD13 cDNA ORF Clone in Cloning Vector, Rat RG8A6679-U
ABHD13 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6679-ACGLN

ABHD13 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ABHD13 cDNA ORF Clone in Cloning Vector, Mouse MG51674-G
ABHD13 cDNA ORF Clone, Mouse, untagged MG51674-UT
ABHD13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51674-ACGLN
ABHD13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51674-ACG
ABHD13 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51674-ANG
ABHD13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51674-ACR
ABHD13 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51674-ANR
ABHD13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51674-CF
ABHD13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51674-NF
ABHD13 cDNA ORF Clone, Mouse, C-His tag MG51674-CH
ABHD13 cDNA ORF Clone, Mouse, N-His tag MG51674-NH
ABHD13 cDNA ORF Clone, Mouse, C-HA tag MG51674-CY
ABHD13 cDNA ORF Clone, Mouse, N-HA tag MG51674-NY
ABHD13 cDNA ORF Clone, Mouse, C-Myc tag MG51674-CM
ABHD13 cDNA ORF Clone, Mouse, N-Myc tag MG51674-NM
ABHD13 qPCR Primer Pairs, Mouse MP201547

ABHD13 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ABHD13 cDNA ORF Clone in Cloning Vector, Human HG27077-U
ABHD13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG27077-ACGLN
info info
添加购物车成功! 添加购物车失败!