Human Coronavirus spike glycoprotein partial ORF mammalian expression plasmid (Codon Optimized)

Cat: VG40021-G-N
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CoV spike Reagents
CRO Services
Product recommended

All CoV spike Reagents
Human Coronavirus spike glycoprotein partial ORF mammalian expression plasmid (Codon Optimized) General Information
Gene
Species
HCoV
RefSeq ORF Size
3903 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with YP_173238.1.
Description
Partial length Clone DNA of Human coronavirus (isolate HKU1) Spike glycoprotein.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
HindIII + XhoI (5.5kb + 3.9kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CoV spike cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Human Coronavirus spike glycoprotein partial ORF mammalian expression plasmid (Codon Optimized) Validated Images
HCoV CoV Spike glycoprotein Gene Plasmid Map 7719
Human Coronavirus spike glycoprotein partial ORF mammalian expression plasmid (Codon Optimized) Alternative Names
S cDNA ORF Clone, HCoV
CoV spike Background Information

The spike (S) glycoprotein of coronaviruses contains protrusions that will only bind to certain receptors on the host cell: they are essential for both host specificity and viral infectivity. The term 'peplomer' is typically used to refer to a grouping of heterologous proteins on the virus surface that function together. The spike (S) glycoprotein of coronaviruses is known to be essential in the binding of the virus to the host cell at the advent of the infection process. Most notable is severe acute respiratory syndrome (SARS). The severe acute respiratory syndrome-coronavirus (SARS-CoV) spike (S) glycoprotein alone can mediate the membrane fusion required for virus entry and cell fusion. It is also a major immunogen and a target for entry inhibitors. The SARS-CoV spike (S) protein is composed of two subunits; the S1 subunit contains a receptor-binding domain that engages with the host cell receptor angiotensin-converting enzyme 2 and the S2 subunit mediates fusion between the viral and host cell membranes. The S protein plays key parts in the induction of neutralizing-antibody and T-cell responses, as well as protective immunity, during infection with SARS-CoV. 

References
  • Shen S, et al. (2007) Expression, glycosylation, and modification of the spike (S) glycoprotein of SARS CoV. Methods Mol Biol. 379: 127-35.
  • Du L, et al. (2009) The spike protein of SARS-CoV--a target for vaccine and therapeutic development. Nat Rev Microbiol. 7 (3): 226-36.
  • Xiao X, et al. (2004) The SARS-CoV S glycoprotein. Cell Mol Life Sci. 61 (19-20): 2428-30.
  • CoV spike cDNA ORF Clone, SARS, Related Products

    Product Name Catalog#(PDF)
    Human SARS coronavirus (SARS-CoV) Spike glycoprotein ORF mammalian expression plasmid (Codon Optimized) VG40150-G-N
    Human SARS coronavirus (SARS-CoV) Spike glycoprotein Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40150-ACGLN

    CoV spike cDNA ORF Clone, MERS-CoV, Related Products

    Product Name Catalog#(PDF)
    MERS-CoV (NCoV / Novel coronavirus) Spike Protein ORF mammalian expression plasmid (Codon Optimized) VG40069-G-N
    MERS-CoV (NCoV / Novel coronavirus) Spike Protein Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40069-ACGLN
    MERS-CoV (NCoV / Novel coronavirus) Spike Protein Gene cDNA Clone / ORF Clone (Codon Optimized), expression ready, C-GFPSpark-tagged VG40069-ACG
    MERS-CoV (NCoV / Novel coronavirus) Spike Protein (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40069-ACR
    MERS-CoV (NCoV / Novel coronavirus) Spike Protein (Codon Optimized) ORF mammalian expression plasmid, C-Flag tag VG40069-CF
    MERS-CoV (NCoV / Novel coronavirus) Spike Protein (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40069-NF
    MERS-CoV (NCoV / Novel coronavirus) Spike Protein (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40069-CH

    CoV spike cDNA ORF Clone, HCoV, Related Products

    Product Name Catalog#(PDF)
    Human Coronavirus spike glycoprotein partial Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40021-ACGLN
    Human Coronavirus spike glycoprotein partial ORF mammalian expression plasmid (Codon Optimized), N-Flag tag VG40021-NF
    info info
    添加购物车成功! 添加购物车失败!