CASP8/ALPS2B cDNA ORF Clone, Human, untagged

Cat: HG10078-M-N
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CASP8/ALPS2B Reagents
CRO Services

All CASP8/ALPS2B Reagents
CASP8/ALPS2B cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1440 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant B.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
HindIII + XbaI (5.5kb + 1.44kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CASP8/ALPS2B cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CASP8/ALPS2B cDNA ORF Clone, Human, untagged Validated Images
Human CREB1 Gene Plasmid Map 7154
CASP8/ALPS2B cDNA ORF Clone, Human, untagged Alternative Names
ALPS2B cDNA ORF Clone, Human;CAP4 cDNA ORF Clone, Human;Casp-8 cDNA ORF Clone, Human;FLICE cDNA ORF Clone, Human;MACH cDNA ORF Clone, Human;MCH5 cDNA ORF Clone, Human
CASP8/ALPS2B Background Information

Caspase 8 is a cysteine dependent endoprotease that plays a key role in the regulation of apoptosis (also referred as programmed cell death), an event which is known to be essential in growth and development of embryo, and maintenance of tissue homeostasis. Caspases are broadly classified as apoptosis or inflammation regulatory caspases based on their role in respective processes. Of those known, caspase - 3, -6, -7, -8 and -9 are categorized as apoptotic caspases, whereas caspase -1, -4, -5 and -12 are grouped as inflammatory caspases. The apoptotic caspases are further classified into initiator caspases (caspase -8 and -9) and effecter caspases (caspase -3, -6 and -7) based on their role in transducing the apoptotic signals emanating at the cell membrane.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
caspase 8, apoptosis-related cysteine peptidase
References
  • Menon U, Raghuram P H, Kannan K, et al. Mutation Analysis of the Dimer Forming Domain of the Caspase 8 Gene in Oral Submucous Fibrosis and Squamous Cell Carcinomas[J]. Asian Pacific journal of cancer prevention: APJCP, 2014, 16(11): 4589-4592.
  • info info
    添加购物车成功! 添加购物车失败!