Quick Order

Text Size:AAA

Human CASP8/ALPS2B transcript variant B Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CASP8/ALPS2B cDNA Clone Product Information
NCBI RefSeq:NM_033355.3
RefSeq ORF Size:1440bp
cDNA Description:Full length Clone DNA of Homo sapiens caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant B.
Gene Synonym:Casp8, CAP4, MACH, MCH5, FLICE, ALPS2B, FLJ17672
Restriction Site:HindIII + XbaI (5.5kb + 1.44kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CASP8/ALPS2B Gene Plasmid Map
Human Caspase-8 / ALPS2B transcript variant B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human CASP8/ALPS2B transcript variant B Gene ORF cDNA clone expression plasmid on other vectors
Product nameProduct name
Size / Price
Catalog: HG10078-M-N
List Price: 
Price:      (You Save: )
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
  • Human Caspase-8 / ALPS2B transcript variant B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.