Quick Order

DatasheetReviewsRelated ProductsProtocols
Human CASP7 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human CASP7 Gene Plasmid Map
Human Caspase-7 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10049-ACG$225
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10049-ACR$225
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10049-ANG$225
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10049-ANR$225
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-Flag tagHG10049-CF$195
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-His tagHG10049-CH$195
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-Myc tagHG10049-CM$195
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-HA tagHG10049-CY$195
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone in cloning vectorHG10049-M$75
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-Flag tagHG10049-M-F$195
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-Flag tagHG10049-NF$195
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-His tagHG10049-NH$195
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-Myc tagHG10049-NM$195
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-HA tagHG10049-NY$195
Human Caspase-7/MCH3 transcript variant alpha Gene ORF cDNA clone expression plasmidHG10049-UT$195
 Learn more about expression Vectors
Product nameProduct name

Caspase 7, also known as caspase-7 and MCH3, belongs to the cysteine-aspartic acid protease (caspase) family. Caspases play a role in the signal transduction pathways of apoptosis, necrosis and inflammation. There are two major classes of caspases: initiators and effectors. The initiator isoforms (caspases-1,-4,-5,-8,-9,-10,-11,-12) are activated by, and interact with, upstream adaptor molecules through protein-protein interaction domains known as CARD and DED. Effector caspases (-3,-6,-7) are responsible for cleaving downstream substrates and are sometimes referred to as the executioner caspases. Caspase 7 exists in lung, skeletal muscle, liver, kidney, spleen and heart, and moderately in testis. Caspase 7 cannot be detected in the brain. Caspase 7 functions in the activation cascade of caspases responsible for apoptosis execution. It cleaves and activates sterol regulatory element binding proteins (SREBPs). It proteolytically cleaves poly(ADP-ribose) polymerase (PARP) at a '216-Asp- -Gly-217' bond. Overexpression promotes programmed cell death.

  • Riedl S J, et al. (2001) Structural basis for the inhibition of caspase-3 by XIAP. Cell. 104(5):791-800.
  • Roy N, et al. (1997) The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. EMBO J. 16(23):6914-25.
  • Deveraux Q L, et al. (1997) X-linked IAP is a direct inhibitor of cell-death proteases. Nature. 388(6639): 300-4.
  • Contact Us
    • Human Caspase-7 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.