Caspase-7 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10049-M-F

NOT AVAILABLE

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Caspase-7 Reagents
CRO Services

All Caspase-7 Reagents
Caspase-7 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
912 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human caspase 7, apoptosis-related cysteine peptidase (CASP7), transcript variant alpha with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 0.94kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Caspase-7 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Caspase-7 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human G-CSF/CSF3 Gene Plasmid Map 7153
Caspase-7 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CASP-7 cDNA ORF Clone, Human;CMH-1 cDNA ORF Clone, Human;ICE-LAP3 cDNA ORF Clone, Human;LICE2 cDNA ORF Clone, Human;MCH3 cDNA ORF Clone, Human
Caspase-7 Background Information

Caspase 7, also known as caspase-7 and MCH3, belongs to the cysteine-aspartic acid protease (caspase) family. Caspases play a role in the signal transduction pathways of apoptosis, necrosis and inflammation. There are two major classes of caspases: initiators and effectors. The initiator isoforms (caspases-1,-4,-5,-8,-9,-10,-11,-12) are activated by, and interact with, upstream adaptor molecules through protein-protein interaction domains known as CARD and DED. Effector caspases (-3,-6,-7) are responsible for cleaving downstream substrates and are sometimes referred to as the executioner caspases. Caspase 7 exists in lung, skeletal muscle, liver, kidney, spleen and heart, and moderately in testis. Caspase 7 cannot be detected in the brain. Caspase 7 functions in the activation cascade of caspases responsible for apoptosis execution. It cleaves and activates sterol regulatory element binding proteins (SREBPs). It proteolytically cleaves poly(ADP-ribose) polymerase (PARP) at a '216-Asp- -Gly-217' bond. Overexpression promotes programmed cell death.

Full Name
caspase 7, apoptosis-related cysteine peptidase
References
  • Riedl S J, et al. (2001) Structural basis for the inhibition of caspase-3 by XIAP. Cell. 104(5):791-800.
  • Roy N, et al. (1997) The c-IAP-1 and c-IAP-2 proteins are direct inhibitors of specific caspases. EMBO J. 16(23):6914-25.
  • Deveraux Q L, et al. (1997) X-linked IAP is a direct inhibitor of cell-death proteases. Nature. 388(6639): 300-4.
  • info info
    添加购物车成功! 添加购物车失败!