Quick Order

Text Size:AAA

Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CASP3 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Human CASP3 Gene Plasmid Map
Human Caspase-3 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10050-ACG$225
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10050-ACR$225
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10050-ANG$225
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10050-ANR$225
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-Flag tagHG10050-CF$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-His tagHG10050-CH$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-Myc tagHG10050-CM$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-HA tagHG10050-CY$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone in cloning vectorHG10050-M$75
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-Flag tagHG10050-NF$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-His tagHG10050-NH$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-Myc tagHG10050-NM$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-HA tagHG10050-NY$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmidHG10050-UT$195
 Learn more about expression Vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.