Quick Order

Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human CASP3 cDNA Clone Product Information
NCBI RefSeq:NM_004346.3
RefSeq ORF Size:834bp
cDNA Description:Full length Clone DNA of Homo sapiens caspase 3, apoptosis-related cysteine peptidase (CASP3), transcript variant alpha with Flag tag.
Gene Synonym:CASP3, CPP32, SCA-1, CPP32B
Restriction Site:KpnI + XhoI (5.5kb + 0.86kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CASP3 Gene Plasmid Map
Human Caspase-3 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Human CASP3 Gene Expression validated Image
Human Caspase-3 transcript variant alpha natural ORF mammalian expression plasmid, Flag tag
[Click to enlarge image]
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10050-ACG$225
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10050-ACR$225
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10050-ANG$225
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10050-ANR$225
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-Flag tagHG10050-CF$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-His tagHG10050-CH$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-Myc tagHG10050-CM$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, C-HA tagHG10050-CY$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone in cloning vectorHG10050-M$75
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-Flag tagHG10050-NF$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-His tagHG10050-NH$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-Myc tagHG10050-NM$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmid, N-HA tagHG10050-NY$195
Human caspase-3 / CASP-3 transcript variant alpha Gene ORF cDNA clone expression plasmidHG10050-UT$195
 Learn more about expression Vectors
Product nameProduct name
Contact Us
  • Human Caspase-3 transcript variant alpha natural ORF mammalian expression plasmid, Flag tag
  • Human Caspase-3 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.